\
| Variant ID: vg0617302802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17302802 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGAAACATGTAATAATTCAGAGCCTCGAACGACACCTAATCGAGTGTGGAGACCCAAGGAGGTAAAAGTTGAGAGACCGGTGGTTCCCCAGAGTAGTGAT[G/A]
AGTTCAATTTGATGAGAGAAGAATCATCGGTCATTAGAGAAGACTCTTCTCCACATGATGCTATCGGTGTTAATGTTGTATTCGTCTTGCCTTCGAAGTC
GACTTCGAAGGCAAGACGAATACAACATTAACACCGATAGCATCATGTGGAGAAGAGTCTTCTCTAATGACCGATGATTCTTCTCTCATCAAATTGAACT[C/T]
ATCACTACTCTGGGGAACCACCGGTCTCTCAACTTTTACCTCCTTGGGTCTCCACACTCGATTAGGTGTCGTTCGAGGCTCTGAATTATTACATGTTTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 17.30% | 0.95% | 0.40% | NA |
| All Indica | 2759 | 99.10% | 0.70% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 44.30% | 52.10% | 2.38% | 1.19% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.40% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 9.30% | 86.30% | 2.09% | 2.35% | NA |
| Tropical Japonica | 504 | 92.50% | 5.00% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 41.90% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 11.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617302802 | G -> A | LOC_Os06g30040.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.553; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0617302802 | G -> DEL | N | N | silent_mutation | Average:47.553; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617302802 | NA | 4.37E-23 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 2.04E-31 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 1.97E-11 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 3.24E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 1.39E-06 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 2.49E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 6.40E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 1.48E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 3.65E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 2.40E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 2.53E-07 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 1.07E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | 3.89E-06 | NA | mr1761_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 1.05E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617302802 | NA | 6.62E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |