Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617167421:

Variant ID: vg0617167421 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17167421
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TACAAGCAAGAATAAGGTAGTTTGCAACTCAATTGCATATGAATGATTACACACTCGAATTTGGGATTTCACAAACCGAATAGCGATGAAACTGCAATTG[T/C]
AAAAATAATTTAAGTGAAACCTGACACTAAACTATAATGGCTACTGAATAAATATGATTAGGGAAGTCCTAGAGTTAGTCCTAAGGCACCACCCCATTGG

Reverse complement sequence

CCAATGGGGTGGTGCCTTAGGACTAACTCTAGGACTTCCCTAATCATATTTATTCAGTAGCCATTATAGTTTAGTGTCAGGTTTCACTTAAATTATTTTT[A/G]
CAATTGCAGTTTCATCGCTATTCGGTTTGTGAAATCCCAAATTCGAGTGTGTAATCATTCATATGCAATTGAGTTGCAAACTACCTTATTCTTGCTTGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	29.10%	0.00%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	14.30%	85.70%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.70%	0.00%	0.00%	NA
Temperate Japonica	767	7.20%	92.80%	0.00%	0.00%	NA
Tropical Japonica	504	27.40%	72.60%	0.00%	0.00%	NA
Japonica Intermediate	241	9.50%	90.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617167421	T -> C	LOC_Os06g29810.1	upstream_gene_variant ; 2556.0bp to feature; MODIFIER	silent_mutation	Average:39.907; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg0617167421	T -> C	LOC_Os06g29810.2	upstream_gene_variant ; 2759.0bp to feature; MODIFIER	silent_mutation	Average:39.907; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg0617167421	T -> C	LOC_Os06g29810.3	upstream_gene_variant ; 2570.0bp to feature; MODIFIER	silent_mutation	Average:39.907; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg0617167421	T -> C	LOC_Os06g29810-LOC_Os06g29820	intergenic_region ; MODIFIER	silent_mutation	Average:39.907; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617167421	NA	1.18E-93	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	2.10E-06	3.84E-89	mr1080	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	3.26E-82	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	8.71E-95	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	2.51E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	1.64E-06	4.61E-102	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	3.64E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	2.16E-92	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	7.87E-36	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	3.47E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	1.41E-78	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	2.83E-94	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	1.87E-69	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	1.94E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	3.75E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	2.75E-33	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	1.99E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	1.42E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	8.12E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617167421	NA	5.15E-22	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251