Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617165924:

Variant ID: vg0617165924 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17165924
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.12, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTTATGATTTGCTTTATTATTAAAAGCACTTTAAGTATGACTTCTCTATTTTTATATTTGCACTAATTTTTTATATAAGACGAATGGTCAAACGTTA[T/C,A]
AAGAAAAAAGTGAAAGCGACTACTAATTTAAAATGGAGGTAGTAAAAGTTATTATTATTACCTTACCGTTTAGATCATATCATACTTAAAAAAATACAAT

Reverse complement sequence

ATTGTATTTTTTTAAGTATGATATGATCTAAACGGTAAGGTAATAATAATAACTTTTACTACCTCCATTTTAAATTAGTAGTCGCTTTCACTTTTTTCTT[A/G,T]
TAACGTTTGACCATTCGTCTTATATAAAAAATTAGTGCAAATATAAAAATAGAGAAGTCATACTTAAAGTGCTTTTAATAATAAAGCAAATCATAAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	30.90%	0.23%	0.93%	T: 28.90%
All Indica	2759	51.90%	45.70%	0.14%	0.58%	T: 1.67%
All Japonica	1512	11.40%	1.70%	0.13%	1.79%	T: 84.99%
Aus	269	40.90%	55.80%	1.12%	0.00%	T: 2.23%
Indica I	595	68.40%	28.40%	0.50%	0.50%	T: 2.18%
Indica II	465	84.10%	14.20%	0.22%	0.43%	T: 1.08%
Indica III	913	21.50%	78.00%	0.00%	0.33%	T: 0.22%
Indica Intermediate	786	55.90%	39.80%	0.00%	1.02%	T: 3.31%
Temperate Japonica	767	1.60%	2.10%	0.00%	3.52%	T: 92.83%
Tropical Japonica	504	28.00%	1.40%	0.20%	0.00%	T: 70.44%
Japonica Intermediate	241	8.30%	0.80%	0.41%	0.00%	T: 90.46%
VI/Aromatic	96	90.60%	7.30%	1.04%	0.00%	T: 1.04%
Intermediate	90	44.40%	22.20%	1.11%	1.11%	T: 31.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617165924	T -> C	LOC_Os06g29810.1	upstream_gene_variant ; 1059.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> C	LOC_Os06g29810.2	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> C	LOC_Os06g29810.3	upstream_gene_variant ; 1073.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> C	LOC_Os06g29810-LOC_Os06g29820	intergenic_region ; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> A	LOC_Os06g29810.1	upstream_gene_variant ; 1059.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> A	LOC_Os06g29810.2	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> A	LOC_Os06g29810.3	upstream_gene_variant ; 1073.0bp to feature; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> A	LOC_Os06g29810-LOC_Os06g29820	intergenic_region ; MODIFIER	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0617165924	T -> DEL	N	N	silent_mutation	Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617165924	NA	5.20E-73	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	3.26E-90	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	9.11E-06	2.26E-85	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	3.93E-06	5.03E-82	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.97E-91	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	4.40E-07	2.43E-39	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.46E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	6.44E-06	8.66E-99	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.05E-90	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.03E-35	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.34E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	3.40E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	3.71E-77	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.12E-91	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	2.14E-69	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	2.04E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	2.12E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	4.07E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924	NA	1.69E-58	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251