\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617165924:

Variant ID: vg0617165924 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17165924
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.12, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTTATGATTTGCTTTATTATTAAAAGCACTTTAAGTATGACTTCTCTATTTTTATATTTGCACTAATTTTTTATATAAGACGAATGGTCAAACGTTA[T/C,A]
AAGAAAAAAGTGAAAGCGACTACTAATTTAAAATGGAGGTAGTAAAAGTTATTATTATTACCTTACCGTTTAGATCATATCATACTTAAAAAAATACAAT

Reverse complement sequence

ATTGTATTTTTTTAAGTATGATATGATCTAAACGGTAAGGTAATAATAATAACTTTTACTACCTCCATTTTAAATTAGTAGTCGCTTTCACTTTTTTCTT[A/G,T]
TAACGTTTGACCATTCGTCTTATATAAAAAATTAGTGCAAATATAAAAATAGAGAAGTCATACTTAAAGTGCTTTTAATAATAAAGCAAATCATAAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 30.90% 0.23% 0.93% T: 28.90%
All Indica  2759 51.90% 45.70% 0.14% 0.58% T: 1.67%
All Japonica  1512 11.40% 1.70% 0.13% 1.79% T: 84.99%
Aus  269 40.90% 55.80% 1.12% 0.00% T: 2.23%
Indica I  595 68.40% 28.40% 0.50% 0.50% T: 2.18%
Indica II  465 84.10% 14.20% 0.22% 0.43% T: 1.08%
Indica III  913 21.50% 78.00% 0.00% 0.33% T: 0.22%
Indica Intermediate  786 55.90% 39.80% 0.00% 1.02% T: 3.31%
Temperate Japonica  767 1.60% 2.10% 0.00% 3.52% T: 92.83%
Tropical Japonica  504 28.00% 1.40% 0.20% 0.00% T: 70.44%
Japonica Intermediate  241 8.30% 0.80% 0.41% 0.00% T: 90.46%
VI/Aromatic  96 90.60% 7.30% 1.04% 0.00% T: 1.04%
Intermediate  90 44.40% 22.20% 1.11% 1.11% T: 31.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617165924 T -> C LOC_Os06g29810.1 upstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> C LOC_Os06g29810.2 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> C LOC_Os06g29810.3 upstream_gene_variant ; 1073.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> C LOC_Os06g29810-LOC_Os06g29820 intergenic_region ; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> A LOC_Os06g29810.1 upstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> A LOC_Os06g29810.2 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> A LOC_Os06g29810.3 upstream_gene_variant ; 1073.0bp to feature; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> A LOC_Os06g29810-LOC_Os06g29820 intergenic_region ; MODIFIER silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg0617165924 T -> DEL N N silent_mutation Average:52.517; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617165924 NA 5.20E-73 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 3.26E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 9.11E-06 2.26E-85 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 3.93E-06 5.03E-82 mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.97E-91 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 4.40E-07 2.43E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.46E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 6.44E-06 8.66E-99 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.05E-90 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.03E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.34E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 3.40E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 3.71E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.12E-91 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 2.14E-69 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 2.04E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 2.12E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 4.07E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617165924 NA 1.69E-58 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251