\
| Variant ID: vg0617122838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17122838 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGATCAATATACTCTCGGCGCATGGACACCCTCTTTTCTGAGGTTTTATTTATCAACCGGTGGAATTTGGCACCTAACGCGGGGCTGCATCGGTTCAGTT[T/C]
GATCTTCGGCGAAGGGGTAAGTCCTATGTTCCATCGGCCCTGGTGAATCTATTAGCTACGTTAGTTGTTCAAGGCTGCATCACTTCGATCTCTTGGATCG
CGATCCAAGAGATCGAAGTGATGCAGCCTTGAACAACTAACGTAGCTAATAGATTCACCAGGGCCGATGGAACATAGGACTTACCCCTTCGCCGAAGATC[A/G]
AACTGAACCGATGCAGCCCCGCGTTAGGTGCCAAATTCCACCGGTTGATAAATAAAACCTCAGAAAAGAGGGTGTCCATGCGCCGAGAGTATATTGATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 17.40% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 45.20% | 52.60% | 2.18% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 12.00% | 86.40% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 6.90% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 54.40% | 40.70% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617122838 | T -> C | LOC_Os06g29780-LOC_Os06g29790 | intergenic_region ; MODIFIER | silent_mutation | Average:43.885; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617122838 | NA | 6.00E-22 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 6.56E-12 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 1.11E-06 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 9.14E-13 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 8.10E-10 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 2.47E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 2.84E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 2.14E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 4.10E-06 | mr1666_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 2.97E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | 1.76E-07 | NA | mr1712_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | 1.51E-06 | NA | mr1712_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | 4.95E-06 | NA | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 1.98E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 8.74E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617122838 | NA | 2.00E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |