\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617102404:

Variant ID: vg0617102404 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17102404
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TACCATGTTCTATACGAAAACAACCTGCGGATATAGGAGGAGTTCCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGATT[G/A]
TATCCATATTGGTTTCCCTAGTTTTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGAGACACCCAACATAGAAG

Reverse complement sequence

CTTCTATGTTGGGTGTCTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAAAACTAGGGAAACCAATATGGATA[C/T]
AATCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGGAACTCCTCCTATATCCGCAGGTTGTTTTCGTATAGAACATGGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 2.20% 2.64% 0.00% NA
All Indica  2759 91.80% 3.70% 4.49% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.20% 9.90% 10.92% 0.00% NA
Indica II  465 90.30% 2.60% 7.10% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 92.90% 3.90% 3.18% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617102404 G -> A LOC_Os06g29770.1 upstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg0617102404 G -> A LOC_Os06g29780.1 upstream_gene_variant ; 4929.0bp to feature; MODIFIER silent_mutation Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg0617102404 G -> A LOC_Os06g29760-LOC_Os06g29770 intergenic_region ; MODIFIER silent_mutation Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617102404 1.15E-07 4.71E-09 mr1002 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 1.36E-09 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 8.37E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 4.36E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 2.76E-11 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 2.47E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 4.74E-07 8.04E-14 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 3.51E-07 1.60E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 5.66E-07 2.00E-13 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 1.87E-06 7.50E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617102404 NA 2.87E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251