\
| Variant ID: vg0617102404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17102404 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
TACCATGTTCTATACGAAAACAACCTGCGGATATAGGAGGAGTTCCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGATT[G/A]
TATCCATATTGGTTTCCCTAGTTTTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGAGACACCCAACATAGAAG
CTTCTATGTTGGGTGTCTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAAAACTAGGGAAACCAATATGGATA[C/T]
AATCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGGAACTCCTCCTATATCCGCAGGTTGTTTTCGTATAGAACATGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 2.20% | 2.64% | 0.00% | NA |
| All Indica | 2759 | 91.80% | 3.70% | 4.49% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.20% | 9.90% | 10.92% | 0.00% | NA |
| Indica II | 465 | 90.30% | 2.60% | 7.10% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 3.90% | 3.18% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617102404 | G -> A | LOC_Os06g29770.1 | upstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0617102404 | G -> A | LOC_Os06g29780.1 | upstream_gene_variant ; 4929.0bp to feature; MODIFIER | silent_mutation | Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0617102404 | G -> A | LOC_Os06g29760-LOC_Os06g29770 | intergenic_region ; MODIFIER | silent_mutation | Average:56.02; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617102404 | 1.15E-07 | 4.71E-09 | mr1002 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 1.36E-09 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 8.37E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 4.36E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 2.76E-11 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 2.47E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | 4.74E-07 | 8.04E-14 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | 3.51E-07 | 1.60E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | 5.66E-07 | 2.00E-13 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | 1.87E-06 | 7.50E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617102404 | NA | 2.87E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |