\
| Variant ID: vg0617033931 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 17033931 |
| Reference Allele: AGAGAT | Alternative Allele: GGAGAT,A |
| Primary Allele: AGAGAT | Secondary Allele: GGAGAT |
Inferred Ancestral Allele: Not determined.
CTAGTAAACTCATGCATTTTAGATCATTTTGGATTTTTACATGTTTTGGCATTTATCGTTACTGTTATTTATTTTAGATGGCGAAATCGATACCGGTAAT[AGAGAT/GGAGAT,A]
GGATTATATCTAATTTCAGTGAGGTCATATATCAACCAAGGCAAGTGTTGCCTTTCCTTTGAACACATTGAATCCCATGTTTTCGGGCTAAATATTTTGA
TCAAAATATTTAGCCCGAAAACATGGGATTCAATGTGTTCAAAGGAAAGGCAACACTTGCCTTGGTTGATATATGACCTCACTGAAATTAGATATAATCC[ATCTCT/ATCTCC,T]
ATTACCGGTATCGATTTCGCCATCTAAAATAAATAACAGTAACGATAAATGCCAAAACATGTAAAAATCCAAAATGATCTAAAATGCATGAGTTTACTAG
| Populations | Population Size | Frequency of AGAGAT(primary allele) | Frequency of GGAGAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.20% | 23.10% | 2.94% | 42.57% | A: 1.18% |
| All Indica | 2759 | 2.60% | 30.40% | 4.49% | 60.53% | A: 1.96% |
| All Japonica | 1512 | 87.20% | 1.70% | 0.40% | 10.71% | A: 0.07% |
| Aus | 269 | 3.30% | 42.00% | 2.23% | 52.42% | NA |
| Indica I | 595 | 4.20% | 12.90% | 2.52% | 79.66% | A: 0.67% |
| Indica II | 465 | 2.40% | 11.80% | 2.37% | 82.37% | A: 1.08% |
| Indica III | 913 | 0.40% | 54.20% | 6.90% | 35.05% | A: 3.40% |
| Indica Intermediate | 786 | 3.90% | 27.10% | 4.45% | 62.72% | A: 1.78% |
| Temperate Japonica | 767 | 96.60% | 1.40% | 0.13% | 1.69% | A: 0.13% |
| Tropical Japonica | 504 | 70.80% | 1.60% | 0.99% | 26.59% | NA |
| Japonica Intermediate | 241 | 91.30% | 2.50% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 1.00% | 88.50% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 32.20% | 31.10% | 3.33% | 32.22% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617033931 | AGAGAT -> A | LOC_Os06g29690.1 | upstream_gene_variant ; 1148.0bp to feature; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> A | LOC_Os06g29679.1 | downstream_gene_variant ; 3611.0bp to feature; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> A | LOC_Os06g29679-LOC_Os06g29690 | intergenic_region ; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> DEL | N | N | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> GGAGAT | LOC_Os06g29690.1 | upstream_gene_variant ; 1149.0bp to feature; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> GGAGAT | LOC_Os06g29679.1 | downstream_gene_variant ; 3610.0bp to feature; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| vg0617033931 | AGAGAT -> GGAGAT | LOC_Os06g29679-LOC_Os06g29690 | intergenic_region ; MODIFIER | silent_mutation | Average:9.121; most accessible tissue: Callus, score: 46.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617033931 | 4.90E-06 | 1.37E-17 | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |