Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617033931:

Variant ID: vg0617033931 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 17033931
Reference Allele: AGAGAT	Alternative Allele: GGAGAT,A
Primary Allele: AGAGAT	Secondary Allele: GGAGAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGTAAACTCATGCATTTTAGATCATTTTGGATTTTTACATGTTTTGGCATTTATCGTTACTGTTATTTATTTTAGATGGCGAAATCGATACCGGTAAT[AGAGAT/GGAGAT,A]
GGATTATATCTAATTTCAGTGAGGTCATATATCAACCAAGGCAAGTGTTGCCTTTCCTTTGAACACATTGAATCCCATGTTTTCGGGCTAAATATTTTGA

Reverse complement sequence

TCAAAATATTTAGCCCGAAAACATGGGATTCAATGTGTTCAAAGGAAAGGCAACACTTGCCTTGGTTGATATATGACCTCACTGAAATTAGATATAATCC[ATCTCT/ATCTCC,T]
ATTACCGGTATCGATTTCGCCATCTAAAATAAATAACAGTAACGATAAATGCCAAAACATGTAAAAATCCAAAATGATCTAAAATGCATGAGTTTACTAG

Allele Frequencies:

Populations	Population Size	Frequency of AGAGAT(primary allele)	Frequency of GGAGAT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.20%	23.10%	2.94%	42.57%	A: 1.18%
All Indica	2759	2.60%	30.40%	4.49%	60.53%	A: 1.96%
All Japonica	1512	87.20%	1.70%	0.40%	10.71%	A: 0.07%
Aus	269	3.30%	42.00%	2.23%	52.42%	NA
Indica I	595	4.20%	12.90%	2.52%	79.66%	A: 0.67%
Indica II	465	2.40%	11.80%	2.37%	82.37%	A: 1.08%
Indica III	913	0.40%	54.20%	6.90%	35.05%	A: 3.40%
Indica Intermediate	786	3.90%	27.10%	4.45%	62.72%	A: 1.78%
Temperate Japonica	767	96.60%	1.40%	0.13%	1.69%	A: 0.13%
Tropical Japonica	504	70.80%	1.60%	0.99%	26.59%	NA
Japonica Intermediate	241	91.30%	2.50%	0.00%	6.22%	NA
VI/Aromatic	96	1.00%	88.50%	0.00%	10.42%	NA
Intermediate	90	32.20%	31.10%	3.33%	32.22%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617033931	AGAGAT -> A	LOC_Os06g29690.1	upstream_gene_variant ; 1148.0bp to feature; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> A	LOC_Os06g29679.1	downstream_gene_variant ; 3611.0bp to feature; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> A	LOC_Os06g29679-LOC_Os06g29690	intergenic_region ; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> DEL	N	N	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> GGAGAT	LOC_Os06g29690.1	upstream_gene_variant ; 1149.0bp to feature; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> GGAGAT	LOC_Os06g29679.1	downstream_gene_variant ; 3610.0bp to feature; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N
vg0617033931	AGAGAT -> GGAGAT	LOC_Os06g29679-LOC_Os06g29690	intergenic_region ; MODIFIER	silent_mutation	Average:9.121; most accessible tissue: Callus, score: 46.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617033931	4.90E-06	1.37E-17	mr1253	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251