Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617013732:

Variant ID: vg0617013732 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17013732
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATAAATTAAAGATTGACACTTGTTATGAATCCAAAAATCATAGTGCAATATATATATTATTAAAGAGAATTGTGACTTTCACTATTTGCTGTTACATG[T/C]
TTATGCGTTACAATGGGTTCTAAAGATAAAAATATGATTTATGTGTTGGGTTTTTACGTTTATTTAGAGAGGTTTTTAGGGTATAGTTTTCTTAAGAGGG

Reverse complement sequence

CCCTCTTAAGAAAACTATACCCTAAAAACCTCTCTAAATAAACGTAAAAACCCAACACATAAATCATATTTTTATCTTTAGAACCCATTGTAACGCATAA[A/G]
CATGTAACAGCAAATAGTGAAAGTCACAATTCTCTTTAATAATATATATATTGCACTATGATTTTTGGATTCATAACAAGTGTCAATCTTTAATTTATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	17.90%	2.14%	38.40%	NA
All Indica	2759	44.00%	0.80%	1.30%	53.93%	NA
All Japonica	1512	31.80%	53.90%	3.64%	10.65%	NA
Aus	269	49.80%	0.00%	1.86%	48.33%	NA
Indica I	595	16.10%	2.50%	2.52%	78.82%	NA
Indica II	465	16.30%	0.40%	2.58%	80.65%	NA
Indica III	913	78.10%	0.00%	0.11%	21.80%	NA
Indica Intermediate	786	41.70%	0.60%	1.02%	56.62%	NA
Temperate Japonica	767	7.40%	88.10%	2.87%	1.56%	NA
Tropical Japonica	504	62.10%	6.90%	4.56%	26.39%	NA
Japonica Intermediate	241	46.10%	43.20%	4.15%	6.64%	NA
VI/Aromatic	96	88.50%	1.00%	0.00%	10.42%	NA
Intermediate	90	55.60%	10.00%	5.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617013732	T -> C	LOC_Os06g29650.1	upstream_gene_variant ; 3502.0bp to feature; MODIFIER	silent_mutation	Average:11.07; most accessible tissue: Callus, score: 69.56	N	N	N	N
vg0617013732	T -> C	LOC_Os06g29650.2	upstream_gene_variant ; 3501.0bp to feature; MODIFIER	silent_mutation	Average:11.07; most accessible tissue: Callus, score: 69.56	N	N	N	N
vg0617013732	T -> C	LOC_Os06g29660.1	downstream_gene_variant ; 1041.0bp to feature; MODIFIER	silent_mutation	Average:11.07; most accessible tissue: Callus, score: 69.56	N	N	N	N
vg0617013732	T -> C	LOC_Os06g29660-LOC_Os06g29670	intergenic_region ; MODIFIER	silent_mutation	Average:11.07; most accessible tissue: Callus, score: 69.56	N	N	N	N
vg0617013732	T -> DEL	N	N	silent_mutation	Average:11.07; most accessible tissue: Callus, score: 69.56	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617013732	NA	1.34E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	1.06E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	1.02E-11	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	1.76E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	8.88E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	7.36E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	9.39E-25	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	6.63E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	3.03E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	8.36E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	3.27E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	1.85E-06	NA	mr1712_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	7.88E-06	NA	mr1712_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	8.76E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	7.70E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617013732	NA	2.92E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251