\
| Variant ID: vg0616986734 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16986734 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 304. )
AGTAAAACTATACTAGAGGGTGGGGCACGCCATTGGCGCGCCGCCTGCCCGAAAGTGATGGGAACAGTAGTAACGTGCAGCTATACAACCGTGCTTAATC[A/G]
TCCAACAGAAGAAAATGAATTAAATATAGAATAGCAGGTGTTTATAGGTAAGCACCTGAACTGCTCATAGATGAGCATGGTGGTTGTTTGGTCTCTCCAA
TTGGAGAGACCAAACAACCACCATGCTCATCTATGAGCAGTTCAGGTGCTTACCTATAAACACCTGCTATTCTATATTTAATTCATTTTCTTCTGTTGGA[T/C]
GATTAAGCACGGTTGTATAGCTGCACGTTACTACTGTTCCCATCACTTTCGGGCAGGCGGCGCGCCAATGGCGTGCCCCACCCTCTAGTATAGTTTTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.70% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 10.90% | 1.41% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.00% | 1.18% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 75.40% | 24.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 7.30% | 2.54% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616986734 | A -> G | LOC_Os06g29620.1 | upstream_gene_variant ; 2578.0bp to feature; MODIFIER | silent_mutation | Average:82.081; most accessible tissue: Callus, score: 88.661 | N | N | N | N |
| vg0616986734 | A -> G | LOC_Os06g29630.1 | downstream_gene_variant ; 4986.0bp to feature; MODIFIER | silent_mutation | Average:82.081; most accessible tissue: Callus, score: 88.661 | N | N | N | N |
| vg0616986734 | A -> G | LOC_Os06g29620-LOC_Os06g29630 | intergenic_region ; MODIFIER | silent_mutation | Average:82.081; most accessible tissue: Callus, score: 88.661 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616986734 | 2.39E-07 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 5.80E-08 | 4.09E-11 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.42E-06 | 4.82E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | NA | 7.32E-07 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 4.54E-06 | NA | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 8.40E-09 | 2.35E-12 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.39E-08 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 4.42E-11 | 3.13E-11 | mr1090_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.22E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.48E-08 | 4.58E-10 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.61E-06 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.62E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | 1.77E-11 | 6.88E-14 | mr1211_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616986734 | NA | 3.05E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |