\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616986734:

Variant ID: vg0616986734 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16986734
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAAAACTATACTAGAGGGTGGGGCACGCCATTGGCGCGCCGCCTGCCCGAAAGTGATGGGAACAGTAGTAACGTGCAGCTATACAACCGTGCTTAATC[A/G]
TCCAACAGAAGAAAATGAATTAAATATAGAATAGCAGGTGTTTATAGGTAAGCACCTGAACTGCTCATAGATGAGCATGGTGGTTGTTTGGTCTCTCCAA

Reverse complement sequence

TTGGAGAGACCAAACAACCACCATGCTCATCTATGAGCAGTTCAGGTGCTTACCTATAAACACCTGCTATTCTATATTTAATTCATTTTCTTCTGTTGGA[T/C]
GATTAAGCACGGTTGTATAGCTGCACGTTACTACTGTTCCCATCACTTTCGGGCAGGCGGCGCGCCAATGGCGTGCCCCACCCTCTAGTATAGTTTTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 6.70% 0.89% 0.00% NA
All Indica  2759 87.60% 10.90% 1.41% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 93.10% 5.20% 1.72% 0.00% NA
Indica III  913 75.40% 24.20% 0.44% 0.00% NA
Indica Intermediate  786 90.20% 7.30% 2.54% 0.00% NA
Temperate Japonica  767 98.60% 1.20% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616986734 A -> G LOC_Os06g29620.1 upstream_gene_variant ; 2578.0bp to feature; MODIFIER silent_mutation Average:82.081; most accessible tissue: Callus, score: 88.661 N N N N
vg0616986734 A -> G LOC_Os06g29630.1 downstream_gene_variant ; 4986.0bp to feature; MODIFIER silent_mutation Average:82.081; most accessible tissue: Callus, score: 88.661 N N N N
vg0616986734 A -> G LOC_Os06g29620-LOC_Os06g29630 intergenic_region ; MODIFIER silent_mutation Average:82.081; most accessible tissue: Callus, score: 88.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616986734 2.39E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 5.80E-08 4.09E-11 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.42E-06 4.82E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 NA 7.32E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 4.54E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 8.40E-09 2.35E-12 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.39E-08 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 4.42E-11 3.13E-11 mr1090_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.22E-06 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.48E-08 4.58E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.61E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.62E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 1.77E-11 6.88E-14 mr1211_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616986734 NA 3.05E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251