Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616962035:

Variant ID: vg0616962035 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16962035
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GAATGGATCGGCTGCAGTGAGTGGGGTCCACAAATCGCGTTTTTTATTGCTGAGTTGGGCTGCAAGCAAGCGATAGTGCGTGGGAAAGAGAGCTATCGTC[A/G]
GGCGATAGATTTGTCGCTCGCTCGCTTCTCTCTCATCGGTTCTCTTCCCTCCACATAGGAATATGATGATGTGGCATATTTTTGGAGCCCGCCTAGTCAG

Reverse complement sequence

CTGACTAGGCGGGCTCCAAAAATATGCCACATCATCATATTCCTATGTGGAGGGAAGAGAACCGATGAGAGAGAAGCGAGCGAGCGACAAATCTATCGCC[T/C]
GACGATAGCTCTCTTTCCCACGCACTATCGCTTGCTTGCAGCCCAACTCAGCAATAAAAAACGCGATTTGTGGACCCCACTCACTGCAGCCGATCCATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	29.70%	0.19%	27.42%	NA
All Indica	2759	53.30%	2.10%	0.18%	44.40%	NA
All Japonica	1512	11.90%	86.60%	0.00%	1.46%	NA
Aus	269	84.40%	1.90%	0.37%	13.38%	NA
Indica I	595	85.40%	2.50%	0.00%	12.10%	NA
Indica II	465	80.90%	1.30%	0.00%	17.85%	NA
Indica III	913	13.50%	1.10%	0.33%	85.10%	NA
Indica Intermediate	786	58.90%	3.60%	0.25%	37.28%	NA
Temperate Japonica	767	1.80%	96.30%	0.00%	1.83%	NA
Tropical Japonica	504	28.80%	70.00%	0.00%	1.19%	NA
Japonica Intermediate	241	8.70%	90.50%	0.00%	0.83%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	52.20%	30.00%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616962035	A -> G	LOC_Os06g29580.1	upstream_gene_variant ; 2838.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0616962035	A -> G	LOC_Os06g29590.1	upstream_gene_variant ; 183.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0616962035	A -> G	LOC_Os06g29590-LOC_Os06g29600	intergenic_region ; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0616962035	A -> DEL	N	N	silent_mutation	Average:74.517; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616962035	NA	1.14E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962035	NA	2.54E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962035	6.56E-06	6.56E-06	mr1877_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251