Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616961888:

Variant ID: vg0616961888 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16961888
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAGAGATGGCTTGCATGGGAGGGGATCGAGATGGCGCACGCGGCGCGGGAGATCGAGCGCCATCGCGCGGGATCGCGCGGGAAGGGCGGAGATCGGGC[G/A]
GGCGCTGGGGTGGAGGGGATGGGGATCTCGATTGGCTATGGTGGGGGAATGGATCGGCTGCAGTGAGTGGGGTCCACAAATCGCGTTTTTTATTGCTGAG

Reverse complement sequence

CTCAGCAATAAAAAACGCGATTTGTGGACCCCACTCACTGCAGCCGATCCATTCCCCCACCATAGCCAATCGAGATCCCCATCCCCTCCACCCCAGCGCC[C/T]
GCCCGATCTCCGCCCTTCCCGCGCGATCCCGCGCGATGGCGCTCGATCTCCCGCGCCGCGTGCGCCATCTCGATCCCCTCCCATGCAAGCCATCTCTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	5.60%	0.89%	26.51%	NA
All Indica	2759	55.30%	0.50%	1.38%	42.84%	NA
All Japonica	1512	87.90%	10.60%	0.00%	1.52%	NA
Aus	269	84.80%	1.90%	0.37%	13.01%	NA
Indica I	595	88.10%	0.00%	0.84%	11.09%	NA
Indica II	465	81.10%	1.50%	0.65%	16.77%	NA
Indica III	913	14.70%	0.40%	1.64%	83.24%	NA
Indica Intermediate	786	62.50%	0.30%	1.91%	35.37%	NA
Temperate Japonica	767	97.90%	0.30%	0.00%	1.83%	NA
Tropical Japonica	504	70.60%	28.00%	0.00%	1.39%	NA
Japonica Intermediate	241	92.10%	7.10%	0.00%	0.83%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	70.00%	12.20%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616961888	G -> A	LOC_Os06g29580.1	upstream_gene_variant ; 2691.0bp to feature; MODIFIER	silent_mutation	Average:73.075; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N
vg0616961888	G -> A	LOC_Os06g29590.1	upstream_gene_variant ; 36.0bp to feature; MODIFIER	silent_mutation	Average:73.075; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N
vg0616961888	G -> A	LOC_Os06g29590-LOC_Os06g29600	intergenic_region ; MODIFIER	silent_mutation	Average:73.075; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N
vg0616961888	G -> DEL	N	N	silent_mutation	Average:73.075; most accessible tissue: Zhenshan97 young leaf, score: 89.772	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0616961888	G	A	-0.02	-0.02	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616961888	NA	7.28E-08	mr1930	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	4.69E-06	NA	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	1.12E-09	NA	mr1082_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	1.56E-09	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	7.04E-07	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	2.03E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	1.38E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	2.01E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	9.37E-07	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	7.15E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616961888	2.77E-07	1.05E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251