\
| Variant ID: vg0616957969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16957969 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 236. )
AGATACCCCGCTGATTGATTACATGCCCTAGGAAAACCACCTCAGGAAGCCAAAATTCACACTTCTTTAATTTAGCATAGAACTTGTTTTCCCGTAAAGT[C/T]
CCTAGCACCATCCTTAAATGATGCTTATGCTCATCTACATCTTTGGAGTAAATCAGAATATCATGAATAAACACCACCACAAACTTATCTAGAAAGCTAT
ATAGCTTTCTAGATAAGTTTGTGGTGGTGTTTATTCATGATATTCTGATTTACTCCAAAGATGTAGATGAGCATAAGCATCATTTAAGGATGGTGCTAGG[G/A]
ACTTTACGGGAAAACAAGTTCTATGCTAAATTAAAGAAGTGTGAATTTTGGCTTCCTGAGGTGGTTTTCCTAGGGCATGTAATCAATCAGCGGGGTATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 6.20% | 1.69% | 24.35% | NA |
| All Indica | 2759 | 57.10% | 0.70% | 2.79% | 39.40% | NA |
| All Japonica | 1512 | 87.90% | 10.60% | 0.13% | 1.32% | NA |
| Aus | 269 | 81.00% | 7.10% | 0.37% | 11.52% | NA |
| Indica I | 595 | 88.60% | 0.00% | 1.18% | 10.25% | NA |
| Indica II | 465 | 83.90% | 1.50% | 0.43% | 14.19% | NA |
| Indica III | 913 | 17.20% | 0.80% | 4.82% | 77.22% | NA |
| Indica Intermediate | 786 | 63.70% | 0.80% | 3.05% | 32.44% | NA |
| Temperate Japonica | 767 | 98.00% | 0.30% | 0.26% | 1.43% | NA |
| Tropical Japonica | 504 | 70.60% | 28.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 91.70% | 7.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 14.40% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616957969 | C -> T | LOC_Os06g29580.1 | synonymous_variant ; p.Gly203Gly; LOW | synonymous_codon | Average:41.578; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| vg0616957969 | C -> DEL | LOC_Os06g29580.1 | N | frameshift_variant | Average:41.578; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616957969 | 6.14E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 1.27E-06 | NA | mr1436 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | NA | 2.28E-06 | mr1930 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 2.86E-08 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 5.75E-09 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 2.75E-07 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 2.56E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 4.63E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 8.80E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 1.72E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 1.49E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | 1.49E-07 | 4.56E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616957969 | NA | 1.45E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |