\
| Variant ID: vg0616954672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16954672 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 195. )
AATACAACCTCGGACATCTAGACAAACTTGTCTACCACTTTCATGTTGAGCACAAAATCAGTTATGCCTCTGAAAATCCCAGATTAAGGAAAACGAATTG[C/T]
TGTCCTGATTTCTGGATCCAGTCAACAGTACTGTTTTTGTTGTTTCTCCCAAACCATTTATCAGAATCGAACGAAACCAGCGGTGTTAGAAAGATATCGA
TCGATATCTTTCTAACACCGCTGGTTTCGTTCGATTCTGATAAATGGTTTGGGAGAAACAACAAAAACAGTACTGTTGACTGGATCCAGAAATCAGGACA[G/A]
CAATTCGTTTTCCTTAATCTGGGATTTTCAGAGGCATAACTGATTTTGTGCTCAACATGAAAGTGGTAGACAAGTTTGTCTAGATGTCCGAGGTTGTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 5.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 89.40% | 10.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.00% | 27.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616954672 | C -> T | LOC_Os06g29580.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.864; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616954672 | 7.39E-06 | NA | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | NA | 1.43E-06 | mr1930 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 4.21E-06 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 5.82E-08 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 1.50E-09 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 1.87E-07 | NA | mr1085_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 3.84E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 5.63E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 8.39E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 8.23E-07 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 2.61E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | 4.82E-08 | 3.66E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616954672 | NA | 1.45E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |