\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616948087:

Variant ID: vg0616948087 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16948087
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAAAAGCTTGCATGTGCTTAGATATACAAAAAAAATCTGCATCTCTATCCAACCTATCTCCTCAACCTACTCTCTCTCCCTAACCTCTTGGGCGACT[G/T]
CAAGAGCAGCGGCGGCGTCAACGAGGGCTCAGCTCAGACCGTCTATCATGTTGCATCTCCTCCCTCTCTCTCTCGACTTTTCTCCTGACGACTGGTGGTC

Reverse complement sequence

GACCACCAGTCGTCAGGAGAAAAGTCGAGAGAGAGAGGGAGGAGATGCAACATGATAGACGGTCTGAGCTGAGCCCTCGTTGACGCCGCCGCTGCTCTTG[C/A]
AGTCGCCCAAGAGGTTAGGGAGAGAGAGTAGGTTGAGGAGATAGGTTGGATAGAGATGCAGATTTTTTTTGTATATCTAAGCACATGCAAGCTTTTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.40% 0.02% 0.23% NA
All Indica  2759 53.70% 46.00% 0.00% 0.33% NA
All Japonica  1512 89.00% 10.90% 0.07% 0.00% NA
Aus  269 85.90% 13.80% 0.00% 0.37% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 79.60% 20.00% 0.00% 0.43% NA
Indica III  913 12.60% 87.20% 0.00% 0.22% NA
Indica Intermediate  786 60.60% 38.80% 0.00% 0.64% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 74.00% 25.80% 0.20% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616948087 G -> T LOC_Os06g29580.1 downstream_gene_variant ; 2272.0bp to feature; MODIFIER silent_mutation Average:68.656; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0616948087 G -> T LOC_Os06g29570-LOC_Os06g29580 intergenic_region ; MODIFIER silent_mutation Average:68.656; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0616948087 G -> DEL N N silent_mutation Average:68.656; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616948087 NA 1.10E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.13E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 7.32E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 6.16E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 3.23E-09 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.32E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 5.62E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.88E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.55E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.53E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 2.02E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 3.40E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.35E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 2.58E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 1.21E-07 NA mr1218_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 7.60E-11 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 2.31E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 4.62E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 1.20E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 7.59E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 6.96E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 4.45E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 3.68E-11 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616948087 NA 3.52E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251