Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616934655:

Variant ID: vg0616934655 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16934655
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TTATATTGTTATTACCATGCCATGGATTCCTTTCTCCAAGATTTAATACTTTTTATTACATAAGGGTGGAGCTACATACAGTACTACTGCAAAAATAACT[G/A]
CCATACTGTCATCAATTAAATGGTATTACATAGGATGCCATCGTTGTGATAAAGGGTACAGCAACAATTCTGATTCACCAAGATGTGCTTGCGAAGTTTC

Reverse complement sequence

GAAACTTCGCAAGCACATCTTGGTGAATCAGAATTGTTGCTGTACCCTTTATCACAACGATGGCATCCTATGTAATACCATTTAATTGATGACAGTATGG[C/T]
AGTTATTTTTGCAGTAGTACTGTATGTAGCTCCACCCTTATGTAATAAAAAGTATTAAATCTTGGAGAAAGGAATCCATGGCATGGTAATAACAATATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	1.90%	4.19%	3.17%	NA
All Indica	2759	90.60%	0.10%	4.53%	4.82%	NA
All Japonica	1512	99.50%	0.00%	0.26%	0.26%	NA
Aus	269	45.00%	30.10%	22.68%	2.23%	NA
Indica I	595	86.10%	0.00%	8.07%	5.88%	NA
Indica II	465	91.60%	0.00%	4.09%	4.30%	NA
Indica III	913	95.30%	0.00%	1.53%	3.18%	NA
Indica Intermediate	786	87.90%	0.30%	5.60%	6.23%	NA
Temperate Japonica	767	99.00%	0.00%	0.52%	0.52%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	1.00%	4.17%	3.12%	NA
Intermediate	90	85.60%	5.60%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616934655	G -> A	LOC_Os06g29570.1	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:36.094; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0616934655	G -> A	LOC_Os06g29550.1	downstream_gene_variant ; 1954.0bp to feature; MODIFIER	silent_mutation	Average:36.094; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0616934655	G -> A	LOC_Os06g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:36.094; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0616934655	G -> DEL	N	N	silent_mutation	Average:36.094; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616934655	NA	2.69E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	4.88E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.86E-25	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	4.09E-17	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	4.53E-19	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	8.09E-07	2.47E-18	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	7.61E-18	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	7.44E-22	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	6.63E-24	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	2.24E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	2.76E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	8.49E-18	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	6.58E-07	1.15E-20	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	3.22E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	6.00E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	4.31E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.15E-15	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.45E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.43E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	3.22E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	5.09E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	1.20E-07	2.83E-24	mr1936	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	5.35E-06	mr1985	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.09E-16	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.68E-22	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	1.14E-17	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	4.72E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616934655	NA	2.33E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251