\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616930764:

Variant ID: vg0616930764 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16930764
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATAGATAATTATCTAGAATGTCGTTGTGTCAGTCCAAATGATGCTGCTTGGCGATTGCAACAATTTGACATCCACCACACAGATCCCTCCGTAGAAC[G/T]
CCTACCTGTCCAACTCCCATTTGAGAATAATGTTATTTTCACAGAAGATGATGATCTTGAAGAGGTCATTGAAGATCCAAACAGCTCTACGACCAAACTA

Reverse complement sequence

TAGTTTGGTCGTAGAGCTGTTTGGATCTTCAATGACCTCTTCAAGATCATCATCTTCTGTGAAAATAACATTATTCTCAAATGGGAGTTGGACAGGTAGG[C/A]
GTTCTACGGAGGGATCTGTGTGGTGGATGTCAAATTGTTGCAATCGCCAAGCAGCATCATTTGGACTGACACAACGACATTCTAGATAATTATCTATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 18.60% 11.19% 0.11% NA
All Indica  2759 54.90% 26.70% 18.27% 0.18% NA
All Japonica  1512 92.80% 6.30% 0.86% 0.00% NA
Aus  269 90.30% 7.40% 2.23% 0.00% NA
Indica I  595 24.20% 42.50% 32.94% 0.34% NA
Indica II  465 29.70% 39.60% 30.32% 0.43% NA
Indica III  913 89.00% 8.10% 2.85% 0.00% NA
Indica Intermediate  786 53.30% 28.60% 17.94% 0.13% NA
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 84.10% 13.70% 2.18% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 73.30% 21.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616930764 G -> T LOC_Os06g29550.1 missense_variant ; p.Arg68Leu; MODERATE nonsynonymous_codon ; R68L Average:11.677; most accessible tissue: Callus, score: 26.43 benign 0.369 DELETERIOUS 0.00
vg0616930764 G -> DEL LOC_Os06g29550.1 N frameshift_variant Average:11.677; most accessible tissue: Callus, score: 26.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616930764 NA 8.66E-06 mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 5.93E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 1.54E-06 8.26E-13 mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 7.30E-06 7.30E-06 mr1151_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 1.69E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 3.16E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 2.27E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 1.55E-06 mr1230_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 2.44E-09 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 8.59E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 6.28E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 1.35E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 1.52E-08 NA mr1422_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 2.66E-07 1.95E-09 mr1422_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 4.93E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 2.68E-06 mr1516_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 6.73E-06 NA mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 2.75E-06 9.51E-15 mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 1.67E-06 3.25E-10 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 2.66E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 8.88E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 6.55E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 NA 1.24E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764 4.34E-06 4.35E-06 mr1981_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251