Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616930764:

Variant ID: vg0616930764 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16930764
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GAAATAGATAATTATCTAGAATGTCGTTGTGTCAGTCCAAATGATGCTGCTTGGCGATTGCAACAATTTGACATCCACCACACAGATCCCTCCGTAGAAC[G/T]
CCTACCTGTCCAACTCCCATTTGAGAATAATGTTATTTTCACAGAAGATGATGATCTTGAAGAGGTCATTGAAGATCCAAACAGCTCTACGACCAAACTA

Reverse complement sequence

TAGTTTGGTCGTAGAGCTGTTTGGATCTTCAATGACCTCTTCAAGATCATCATCTTCTGTGAAAATAACATTATTCTCAAATGGGAGTTGGACAGGTAGG[C/A]
GTTCTACGGAGGGATCTGTGTGGTGGATGTCAAATTGTTGCAATCGCCAAGCAGCATCATTTGGACTGACACAACGACATTCTAGATAATTATCTATTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	18.60%	11.19%	0.11%	NA
All Indica	2759	54.90%	26.70%	18.27%	0.18%	NA
All Japonica	1512	92.80%	6.30%	0.86%	0.00%	NA
Aus	269	90.30%	7.40%	2.23%	0.00%	NA
Indica I	595	24.20%	42.50%	32.94%	0.34%	NA
Indica II	465	29.70%	39.60%	30.32%	0.43%	NA
Indica III	913	89.00%	8.10%	2.85%	0.00%	NA
Indica Intermediate	786	53.30%	28.60%	17.94%	0.13%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	84.10%	13.70%	2.18%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.41%	0.00%	NA
VI/Aromatic	96	88.50%	10.40%	1.04%	0.00%	NA
Intermediate	90	73.30%	21.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616930764	G -> T	LOC_Os06g29550.1	missense_variant ; p.Arg68Leu; MODERATE	nonsynonymous_codon ; R68L	Average:11.677; most accessible tissue: Callus, score: 26.43	benign	0.369	DELETERIOUS	0.00
vg0616930764	G -> DEL	LOC_Os06g29550.1	N	frameshift_variant	Average:11.677; most accessible tissue: Callus, score: 26.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616930764	NA	8.66E-06	mr1049_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	5.93E-06	mr1066_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	1.54E-06	8.26E-13	mr1151_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	7.30E-06	7.30E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	1.69E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	3.16E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	2.27E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	1.55E-06	mr1230_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	2.44E-09	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	8.59E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	6.28E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	1.35E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	1.52E-08	NA	mr1422_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	2.66E-07	1.95E-09	mr1422_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	4.93E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	2.68E-06	mr1516_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	6.73E-06	NA	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	2.75E-06	9.51E-15	mr1583_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	1.67E-06	3.25E-10	mr1583_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	2.66E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	8.88E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	6.55E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	NA	1.24E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616930764	4.34E-06	4.35E-06	mr1981_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251