Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616908094:

Variant ID: vg0616908094 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16908094
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCCAAAATAACGCCGTCAATACCTGCATAAAACCATAAAAGTAAAACATCTAATGTAGTGGTAGGGTTTATTTCTAACCATTTCCACGAGTGTTGGTG[C/T]
ATATTTGGATGCAGGTGACGAACCACCAAAGTTGAGACAAAAGATACATGGAGGAGGAGGTGAATTAAACATCCATTTTCCAGCCTATGGAGCTTTGGAC

Reverse complement sequence

GTCCAAAGCTCCATAGGCTGGAAAATGGATGTTTAATTCACCTCCTCCTCCATGTATCTTTTGTCTCAACTTTGGTGGTTCGTCACCTGCATCCAAATAT[G/A]
CACCAACACTCGTGGAAATGGTTAGAAATAAACCCTACCACTACATTAGATGTTTTACTTTTATGGTTTTATGCAGGTATTGACGGCGTTATTTTGGCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.90%	0.00%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	9.40%	90.60%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	3.20%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	18.30%	81.70%	0.00%	0.00%	NA
Japonica Intermediate	241	8.70%	91.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616908094	C -> T	LOC_Os06g29490.1	upstream_gene_variant ; 2891.0bp to feature; MODIFIER	silent_mutation	Average:45.3; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0616908094	C -> T	LOC_Os06g29490.2	upstream_gene_variant ; 2891.0bp to feature; MODIFIER	silent_mutation	Average:45.3; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0616908094	C -> T	LOC_Os06g29480.1	downstream_gene_variant ; 4112.0bp to feature; MODIFIER	silent_mutation	Average:45.3; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0616908094	C -> T	LOC_Os06g29480-LOC_Os06g29490	intergenic_region ; MODIFIER	silent_mutation	Average:45.3; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616908094	NA	1.06E-73	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	4.14E-58	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	1.38E-10	3.23E-76	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	6.03E-89	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	6.56E-83	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	2.16E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.90E-34	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	2.48E-07	NA	mr1132	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.42E-90	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	4.18E-07	2.73E-39	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	3.61E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	2.99E-99	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.53E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	2.07E-91	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	2.28E-35	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.93E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.56E-17	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	2.09E-06	3.55E-72	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	9.06E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	3.42E-76	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	4.58E-93	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.04E-66	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	1.07E-15	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	8.97E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	2.67E-09	4.48E-98	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	4.46E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616908094	NA	3.17E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251