\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616884771:

Variant ID: vg0616884771 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16884771
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CACACACACACAAACACTAGCAAAAGTGCTCGTGCGTTGCACCGGGTGATTACGAAGTGTATACAGTGACAAAAAGTGTTATTTGGTTTAGACAATTAAT[T/C]
TGCTCAAAAGAAATTGTTTGTTATTTGTTTTAGACAACTAATCTGCTAAAAAAGATGACGGATGAAAATTTGTATCATGAAGAAAAATATTTATTTTTAT

Reverse complement sequence

ATAAAAATAAATATTTTTCTTCATGATACAAATTTTCATCCGTCATCTTTTTTAGCAGATTAGTTGTCTAAAACAAATAACAAACAATTTCTTTTGAGCA[A/G]
ATTAATTGTCTAAACCAAATAACACTTTTTGTCACTGTATACACTTCGTAATCACCCGGTGCAACGCACGAGCACTTTTGCTAGTGTTTGTGTGTGTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.40% 0.80% 17.29% 63.44% NA
All Indica  2759 0.70% 0.50% 3.30% 95.51% NA
All Japonica  1512 55.40% 1.10% 28.11% 15.41% NA
Aus  269 0.70% 1.50% 72.49% 25.28% NA
Indica I  595 2.20% 0.30% 4.03% 93.45% NA
Indica II  465 0.20% 0.60% 3.01% 96.13% NA
Indica III  913 0.00% 0.40% 0.77% 98.80% NA
Indica Intermediate  786 0.50% 0.80% 5.85% 92.88% NA
Temperate Japonica  767 91.70% 0.30% 3.00% 5.08% NA
Tropical Japonica  504 7.50% 1.80% 66.67% 24.01% NA
Japonica Intermediate  241 40.20% 2.10% 27.39% 30.29% NA
VI/Aromatic  96 1.00% 5.20% 83.33% 10.42% NA
Intermediate  90 13.30% 0.00% 28.89% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616884771 T -> C LOC_Os06g29460.1 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0616884771 T -> C LOC_Os06g29460.2 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0616884771 T -> C LOC_Os06g29460.3 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0616884771 T -> C LOC_Os06g29460-LOC_Os06g29470 intergenic_region ; MODIFIER silent_mutation Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0616884771 T -> DEL N N silent_mutation Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616884771 NA 1.66E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 2.83E-06 NA mr1206_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 6.33E-07 mr1206_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 5.48E-06 2.76E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 2.68E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 3.10E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 2.45E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 6.10E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 2.60E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 8.37E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 5.12E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 1.04E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 4.18E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 5.55E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771 NA 4.96E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251