\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616844584:

Variant ID: vg0616844584 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16844584
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATACTACCAATGTTTACAAAATTGACATATCTGTGTTGATATTTATAAACCAGATGAGAGAAATGTGATTATTGTGAATAGTATAACTATCACTTTGAC[G/A]
GATGAAGAAGTGATCAAAATAAAAGTTGTACATACTGATGAGAGGATCAACTTTGTTTTTGACCATATTTCCATTTGAAATCATTTAGTATTTACAAATG

Reverse complement sequence

CATTTGTAAATACTAAATGATTTCAAATGGAAATATGGTCAAAAACAAAGTTGATCCTCTCATCAGTATGTACAACTTTTATTTTGATCACTTCTTCATC[C/T]
GTCAAAGTGATAGTTATACTATTCACAATAATCACATTTCTCTCATCTGGTTTATAAATATCAACACAGATATGTCAATTTTGTAAACATTGGTAGTATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 4.20% 0.76% 0.30% NA
All Indica  2759 99.60% 0.30% 0.07% 0.00% NA
All Japonica  1512 85.10% 12.20% 1.98% 0.73% NA
Aus  269 98.90% 0.00% 0.74% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.80% 0.25% 0.00% NA
Temperate Japonica  767 98.60% 0.80% 0.65% 0.00% NA
Tropical Japonica  504 64.10% 30.60% 3.17% 2.18% NA
Japonica Intermediate  241 85.90% 10.40% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616844584 G -> A LOC_Os06g29410.1 upstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0616844584 G -> A LOC_Os06g29420.1 downstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0616844584 G -> A LOC_Os06g29410-LOC_Os06g29420 intergenic_region ; MODIFIER silent_mutation Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0616844584 G -> DEL N N silent_mutation Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616844584 NA 1.21E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616844584 3.73E-07 1.05E-09 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616844584 NA 4.53E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616844584 NA 3.84E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616844584 NA 4.08E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251