| Variant ID: vg0616844584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16844584 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATACTACCAATGTTTACAAAATTGACATATCTGTGTTGATATTTATAAACCAGATGAGAGAAATGTGATTATTGTGAATAGTATAACTATCACTTTGAC[G/A]
GATGAAGAAGTGATCAAAATAAAAGTTGTACATACTGATGAGAGGATCAACTTTGTTTTTGACCATATTTCCATTTGAAATCATTTAGTATTTACAAATG
CATTTGTAAATACTAAATGATTTCAAATGGAAATATGGTCAAAAACAAAGTTGATCCTCTCATCAGTATGTACAACTTTTATTTTGATCACTTCTTCATC[C/T]
GTCAAAGTGATAGTTATACTATTCACAATAATCACATTTCTCTCATCTGGTTTATAAATATCAACACAGATATGTCAATTTTGTAAACATTGGTAGTATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 4.20% | 0.76% | 0.30% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 85.10% | 12.20% | 1.98% | 0.73% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 0.80% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 64.10% | 30.60% | 3.17% | 2.18% | NA |
| Japonica Intermediate | 241 | 85.90% | 10.40% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616844584 | G -> A | LOC_Os06g29410.1 | upstream_gene_variant ; 1878.0bp to feature; MODIFIER | silent_mutation | Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0616844584 | G -> A | LOC_Os06g29420.1 | downstream_gene_variant ; 982.0bp to feature; MODIFIER | silent_mutation | Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0616844584 | G -> A | LOC_Os06g29410-LOC_Os06g29420 | intergenic_region ; MODIFIER | silent_mutation | Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0616844584 | G -> DEL | N | N | silent_mutation | Average:17.578; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616844584 | NA | 1.21E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616844584 | 3.73E-07 | 1.05E-09 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616844584 | NA | 4.53E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616844584 | NA | 3.84E-06 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616844584 | NA | 4.08E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |