\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616819865:

Variant ID: vg0616819865 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16819865
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGAAAATTGTAGAAAAACTAGAAAACTAATAAATATATGTTCTAAATAAGTCATAAGTGTTATATACACGTTATAAGTAATAAACGCGCCAACTGGCA[G/C]
GCCATTTTCTAGTTCAATACTAGATTGATTTTTTATGGGACGGAGGGAGTATGAATGAAGTAGACTGAGGCTGTGTTTAGTTCCCTTTAAACTTCCAAAA

Reverse complement sequence

TTTTGGAAGTTTAAAGGGAACTAAACACAGCCTCAGTCTACTTCATTCATACTCCCTCCGTCCCATAAAAAATCAATCTAGTATTGAACTAGAAAATGGC[C/G]
TGCCAGTTGGCGCGTTTATTACTTATAACGTGTATATAACACTTATGACTTATTTAGAACATATATTTATTAGTTTTCTAGTTTTTCTACAATTTTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 33.10% 0.04% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 9.30% 90.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 18.50% 81.50% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616819865 G -> C LOC_Os06g29390-LOC_Os06g29400 intergenic_region ; MODIFIER silent_mutation Average:47.012; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616819865 NA 1.96E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 7.20E-13 4.12E-84 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 2.62E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 1.79E-75 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 4.25E-10 1.22E-44 mr1176 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 7.91E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 8.75E-08 4.39E-79 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 3.88E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 1.50E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 2.99E-67 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 1.17E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 7.51E-71 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 9.81E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 1.09E-20 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 6.24E-14 8.76E-112 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 3.63E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 5.58E-06 2.66E-20 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 4.61E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 3.36E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 2.13E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 5.46E-07 1.66E-101 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 3.57E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 4.42E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616819865 NA 3.05E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251