\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616660850:

Variant ID: vg0616660850 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16660850
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCACAAGCCATCCTTATATCCCCTTGCACGCCTGCATCGTTGGTGTGGCTTGCTGAGTACGGTGGTTGTACTCAGCCTTGCTATTATTTCCCCCTTTT[T/C]
AGAAGTGTAGTGCTTCTGAGCTGAAGACGAAGTTAGAAGACCAAGGCTCAGACCCCAGTTGAGTTTTGCCTGTGGAGTGGAGCTGAAGCCCCGCTAGGAT

Reverse complement sequence

ATCCTAGCGGGGCTTCAGCTCCACTCCACAGGCAAAACTCAACTGGGGTCTGAGCCTTGGTCTTCTAACTTCGTCTTCAGCTCAGAAGCACTACACTTCT[A/G]
AAAAGGGGGAAATAATAGCAAGGCTGAGTACAACCACCGTACTCAGCAAGCCACACCAACGATGCAGGCGTGCAAGGGGATATAAGGATGGCTTGTGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 32.10% 6.26% 9.78% NA
All Indica  2759 70.10% 3.60% 10.11% 16.20% NA
All Japonica  1512 8.90% 90.90% 0.13% 0.00% NA
Aus  269 90.70% 2.20% 2.23% 4.83% NA
Indica I  595 72.30% 2.90% 13.28% 11.60% NA
Indica II  465 70.50% 2.80% 12.26% 14.41% NA
Indica III  913 68.80% 2.40% 6.79% 22.02% NA
Indica Intermediate  786 69.70% 6.00% 10.31% 13.99% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 17.50% 82.10% 0.40% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 4.20% 2.08% 1.04% NA
Intermediate  90 56.70% 34.40% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616660850 T -> C LOC_Os06g29190.1 upstream_gene_variant ; 2072.0bp to feature; MODIFIER silent_mutation Average:40.851; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0616660850 T -> C LOC_Os06g29200.1 upstream_gene_variant ; 4198.0bp to feature; MODIFIER silent_mutation Average:40.851; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0616660850 T -> C LOC_Os06g29190-LOC_Os06g29200 intergenic_region ; MODIFIER silent_mutation Average:40.851; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0616660850 T -> DEL N N silent_mutation Average:40.851; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616660850 NA 1.39E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 3.08E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 3.65E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 8.91E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.48E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 3.74E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.08E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.26E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.47E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 8.14E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.20E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.34E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 2.47E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 7.85E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.29E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.23E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 2.93E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 2.08E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 NA 1.33E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616660850 2.12E-06 8.46E-07 mr1968 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251