Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616244147:

Variant ID: vg0616244147 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16244147
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGTCCTAAACACCTTAGGAAACCCACTAGTACAAGAAAGAAACTTTACATAACCAATCGTACCAAATTTGGACTCCTTCCAAATTCAACTTCGCATCC[T/C]
ATACGCACACAATAACTCCATCGTATGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACAACGG

Reverse complement sequence

CCGTTGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCATACGATGGAGTTATTGTGTGCGTAT[A/G]
GGATGCGAAGTTGAATTTGGAAGGAGTCCAAATTTGGTACGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGTGGGTTTCCTAAGGTGTTTAGGACTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	31.10%	0.04%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.04%	0.00%	NA
All Japonica	1512	9.10%	90.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.50%	4.50%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	17.70%	82.30%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616244147	T -> C	LOC_Os06g28540.1	upstream_gene_variant ; 702.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0616244147	T -> C	LOC_Os06g28550.1	downstream_gene_variant ; 201.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0616244147	T -> C	LOC_Os06g28550.2	downstream_gene_variant ; 1527.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0616244147	T -> C	LOC_Os06g28540-LOC_Os06g28550	intergenic_region ; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616244147	2.20E-09	1.53E-09	mr1071	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	1.04E-06	2.34E-07	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	2.77E-06	3.30E-07	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	2.30E-06	2.30E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	1.23E-06	3.10E-08	mr1203	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	3.15E-06	3.19E-07	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	8.49E-06	1.83E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	NA	2.98E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	4.83E-09	2.19E-09	mr1071_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	2.17E-09	4.12E-09	mr1080_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	3.41E-06	NA	mr1100_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	1.57E-09	4.67E-09	mr1203_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	1.16E-06	5.90E-09	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616244147	2.16E-06	1.46E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251