\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616238331:

Variant ID: vg0616238331 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16238331
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CCGGTGGTCGGTCTGACCGAGGCTGTTCAACCGGTCTGACCGGTCGCCAGTCTAACCGCGGGACCCACTGCGGTCTGACCGGTGTCCTCGAGGGAAAACC[G/C,T]
GATTTTTGCCACTTTGATTTTGCAAAAGCAATCTCTCTCTCCTTTTTCTGTTTATGAGCTAATCTGAAACAAAAATCAACAATATGTCCATCTTTGCCAA

Reverse complement sequence

TTGGCAAAGATGGACATATTGTTGATTTTTGTTTCAGATTAGCTCATAAACAGAAAAAGGAGAGAGAGATTGCTTTTGCAAAATCAAAGTGGCAAAAATC[C/G,A]
GGTTTTCCCTCGAGGACACCGGTCAGACCGCAGTGGGTCCCGCGGTTAGACTGGCGACCGGTCAGACCGGTTGAACAGCCTCGGTCAGACCGACCACCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 32.30% 1.08% 28.48% T: 0.08%
All Indica  2759 51.50% 4.00% 1.45% 42.95% T: 0.04%
All Japonica  1512 1.40% 91.10% 0.40% 7.08% NA
Aus  269 81.80% 1.90% 1.49% 14.87% NA
Indica I  595 83.70% 4.20% 1.85% 10.25% NA
Indica II  465 73.30% 3.00% 0.43% 23.23% NA
Indica III  913 15.20% 1.30% 1.97% 81.49% NA
Indica Intermediate  786 56.50% 7.60% 1.15% 34.61% T: 0.13%
Temperate Japonica  767 1.60% 96.30% 0.00% 2.09% NA
Tropical Japonica  504 0.80% 82.90% 0.79% 15.48% NA
Japonica Intermediate  241 2.10% 91.70% 0.83% 5.39% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 43.30% 36.70% 1.11% 15.56% T: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616238331 G -> C LOC_Os06g28530.1 upstream_gene_variant ; 1215.0bp to feature; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> C LOC_Os06g28540.1 downstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> C LOC_Os06g28530-LOC_Os06g28540 intergenic_region ; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> T LOC_Os06g28530.1 upstream_gene_variant ; 1215.0bp to feature; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> T LOC_Os06g28540.1 downstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> T LOC_Os06g28530-LOC_Os06g28540 intergenic_region ; MODIFIER silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0616238331 G -> DEL N N silent_mutation Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616238331 NA 1.59E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 4.67E-06 4.67E-06 mr1011 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 2.73E-06 2.73E-06 mr1012 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 6.29E-73 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 3.93E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 3.74E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 3.18E-06 6.90E-40 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 1.04E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 1.02E-07 4.41E-72 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 5.93E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 5.33E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 1.33E-36 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 2.91E-97 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 2.64E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331 NA 2.82E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251