Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616238331:

Variant ID: vg0616238331 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16238331
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CCGGTGGTCGGTCTGACCGAGGCTGTTCAACCGGTCTGACCGGTCGCCAGTCTAACCGCGGGACCCACTGCGGTCTGACCGGTGTCCTCGAGGGAAAACC[G/C,T]
GATTTTTGCCACTTTGATTTTGCAAAAGCAATCTCTCTCTCCTTTTTCTGTTTATGAGCTAATCTGAAACAAAAATCAACAATATGTCCATCTTTGCCAA

Reverse complement sequence

TTGGCAAAGATGGACATATTGTTGATTTTTGTTTCAGATTAGCTCATAAACAGAAAAAGGAGAGAGAGATTGCTTTTGCAAAATCAAAGTGGCAAAAATC[C/G,A]
GGTTTTCCCTCGAGGACACCGGTCAGACCGCAGTGGGTCCCGCGGTTAGACTGGCGACCGGTCAGACCGGTTGAACAGCCTCGGTCAGACCGACCACCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	32.30%	1.08%	28.48%	T: 0.08%
All Indica	2759	51.50%	4.00%	1.45%	42.95%	T: 0.04%
All Japonica	1512	1.40%	91.10%	0.40%	7.08%	NA
Aus	269	81.80%	1.90%	1.49%	14.87%	NA
Indica I	595	83.70%	4.20%	1.85%	10.25%	NA
Indica II	465	73.30%	3.00%	0.43%	23.23%	NA
Indica III	913	15.20%	1.30%	1.97%	81.49%	NA
Indica Intermediate	786	56.50%	7.60%	1.15%	34.61%	T: 0.13%
Temperate Japonica	767	1.60%	96.30%	0.00%	2.09%	NA
Tropical Japonica	504	0.80%	82.90%	0.79%	15.48%	NA
Japonica Intermediate	241	2.10%	91.70%	0.83%	5.39%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	36.70%	1.11%	15.56%	T: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616238331	G -> C	LOC_Os06g28530.1	upstream_gene_variant ; 1215.0bp to feature; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> C	LOC_Os06g28540.1	downstream_gene_variant ; 3479.0bp to feature; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> C	LOC_Os06g28530-LOC_Os06g28540	intergenic_region ; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> T	LOC_Os06g28530.1	upstream_gene_variant ; 1215.0bp to feature; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> T	LOC_Os06g28540.1	downstream_gene_variant ; 3479.0bp to feature; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> T	LOC_Os06g28530-LOC_Os06g28540	intergenic_region ; MODIFIER	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0616238331	G -> DEL	N	N	silent_mutation	Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616238331	NA	1.59E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	4.67E-06	4.67E-06	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	2.73E-06	2.73E-06	mr1012	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	6.29E-73	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	3.93E-80	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	3.74E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	3.18E-06	6.90E-40	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	1.04E-35	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	1.02E-07	4.41E-72	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	5.93E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	5.33E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	1.33E-36	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	2.91E-97	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	2.64E-24	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616238331	NA	2.82E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251