\
| Variant ID: vg0616238331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16238331 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )
CCGGTGGTCGGTCTGACCGAGGCTGTTCAACCGGTCTGACCGGTCGCCAGTCTAACCGCGGGACCCACTGCGGTCTGACCGGTGTCCTCGAGGGAAAACC[G/C,T]
GATTTTTGCCACTTTGATTTTGCAAAAGCAATCTCTCTCTCCTTTTTCTGTTTATGAGCTAATCTGAAACAAAAATCAACAATATGTCCATCTTTGCCAA
TTGGCAAAGATGGACATATTGTTGATTTTTGTTTCAGATTAGCTCATAAACAGAAAAAGGAGAGAGAGATTGCTTTTGCAAAATCAAAGTGGCAAAAATC[C/G,A]
GGTTTTCCCTCGAGGACACCGGTCAGACCGCAGTGGGTCCCGCGGTTAGACTGGCGACCGGTCAGACCGGTTGAACAGCCTCGGTCAGACCGACCACCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 32.30% | 1.08% | 28.48% | T: 0.08% |
| All Indica | 2759 | 51.50% | 4.00% | 1.45% | 42.95% | T: 0.04% |
| All Japonica | 1512 | 1.40% | 91.10% | 0.40% | 7.08% | NA |
| Aus | 269 | 81.80% | 1.90% | 1.49% | 14.87% | NA |
| Indica I | 595 | 83.70% | 4.20% | 1.85% | 10.25% | NA |
| Indica II | 465 | 73.30% | 3.00% | 0.43% | 23.23% | NA |
| Indica III | 913 | 15.20% | 1.30% | 1.97% | 81.49% | NA |
| Indica Intermediate | 786 | 56.50% | 7.60% | 1.15% | 34.61% | T: 0.13% |
| Temperate Japonica | 767 | 1.60% | 96.30% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 0.80% | 82.90% | 0.79% | 15.48% | NA |
| Japonica Intermediate | 241 | 2.10% | 91.70% | 0.83% | 5.39% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 36.70% | 1.11% | 15.56% | T: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616238331 | G -> C | LOC_Os06g28530.1 | upstream_gene_variant ; 1215.0bp to feature; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> C | LOC_Os06g28540.1 | downstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> C | LOC_Os06g28530-LOC_Os06g28540 | intergenic_region ; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> T | LOC_Os06g28530.1 | upstream_gene_variant ; 1215.0bp to feature; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> T | LOC_Os06g28540.1 | downstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> T | LOC_Os06g28530-LOC_Os06g28540 | intergenic_region ; MODIFIER | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg0616238331 | G -> DEL | N | N | silent_mutation | Average:29.272; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616238331 | NA | 1.59E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | 4.67E-06 | 4.67E-06 | mr1011 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | 2.73E-06 | 2.73E-06 | mr1012 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 6.29E-73 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 3.93E-80 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 3.74E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | 3.18E-06 | 6.90E-40 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 1.04E-35 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | 1.02E-07 | 4.41E-72 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 5.93E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 5.33E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 1.33E-36 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 2.91E-97 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 2.64E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616238331 | NA | 2.82E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |