\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616229238:

Variant ID: vg0616229238 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16229238
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CACTAGTACAAGAAAGAAACTTTACATAACCAATCATACCAAATTTGGATTCCTTCCAAATTCAACTCCGCATCCCATACGCACACAATAACTCCATCGT[T/A]
TGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACAACGGACGTCGTCTTATCCCCAAGACGACT

Reverse complement sequence

AGTCGTCTTGGGGATAAGACGACGTCCGTTGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCA[A/T]
ACGATGGAGTTATTGTGTGCGTATGGGATGCGGAGTTGAATTTGGAAGGAATCCAAATTTGGTATGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 31.70% 10.71% 11.72% NA
All Indica  2759 61.20% 2.80% 16.96% 19.06% NA
All Japonica  1512 6.90% 91.30% 1.39% 0.40% NA
Aus  269 88.10% 1.50% 2.97% 7.43% NA
Indica I  595 86.20% 3.00% 3.53% 7.23% NA
Indica II  465 77.80% 1.50% 12.04% 8.60% NA
Indica III  913 34.70% 1.20% 31.00% 33.08% NA
Indica Intermediate  786 63.20% 5.10% 13.74% 17.94% NA
Temperate Japonica  767 2.30% 96.30% 0.65% 0.65% NA
Tropical Japonica  504 13.50% 83.50% 2.78% 0.20% NA
Japonica Intermediate  241 7.50% 91.70% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 50.00% 37.80% 10.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616229238 T -> A LOC_Os06g28524.1 downstream_gene_variant ; 3928.0bp to feature; MODIFIER silent_mutation Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0616229238 T -> A LOC_Os06g28524-LOC_Os06g28530 intergenic_region ; MODIFIER silent_mutation Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0616229238 T -> DEL N N silent_mutation Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616229238 NA 2.55E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 NA 3.85E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 7.04E-06 4.31E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 NA 9.05E-09 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 4.10E-07 4.10E-07 mr1477_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 NA 3.66E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 NA 1.48E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238 6.94E-06 6.94E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251