\
| Variant ID: vg0616229238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16229238 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.04, others allele: 0.00, population size: 82. )
CACTAGTACAAGAAAGAAACTTTACATAACCAATCATACCAAATTTGGATTCCTTCCAAATTCAACTCCGCATCCCATACGCACACAATAACTCCATCGT[T/A]
TGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACAACGGACGTCGTCTTATCCCCAAGACGACT
AGTCGTCTTGGGGATAAGACGACGTCCGTTGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCA[A/T]
ACGATGGAGTTATTGTGTGCGTATGGGATGCGGAGTTGAATTTGGAAGGAATCCAAATTTGGTATGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 31.70% | 10.71% | 11.72% | NA |
| All Indica | 2759 | 61.20% | 2.80% | 16.96% | 19.06% | NA |
| All Japonica | 1512 | 6.90% | 91.30% | 1.39% | 0.40% | NA |
| Aus | 269 | 88.10% | 1.50% | 2.97% | 7.43% | NA |
| Indica I | 595 | 86.20% | 3.00% | 3.53% | 7.23% | NA |
| Indica II | 465 | 77.80% | 1.50% | 12.04% | 8.60% | NA |
| Indica III | 913 | 34.70% | 1.20% | 31.00% | 33.08% | NA |
| Indica Intermediate | 786 | 63.20% | 5.10% | 13.74% | 17.94% | NA |
| Temperate Japonica | 767 | 2.30% | 96.30% | 0.65% | 0.65% | NA |
| Tropical Japonica | 504 | 13.50% | 83.50% | 2.78% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 91.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 37.80% | 10.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616229238 | T -> A | LOC_Os06g28524.1 | downstream_gene_variant ; 3928.0bp to feature; MODIFIER | silent_mutation | Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0616229238 | T -> A | LOC_Os06g28524-LOC_Os06g28530 | intergenic_region ; MODIFIER | silent_mutation | Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0616229238 | T -> DEL | N | N | silent_mutation | Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616229238 | NA | 2.55E-07 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | NA | 3.85E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | 7.04E-06 | 4.31E-08 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | NA | 9.05E-09 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | 4.10E-07 | 4.10E-07 | mr1477_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | NA | 3.66E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | NA | 1.48E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616229238 | 6.94E-06 | 6.94E-06 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |