\
| Variant ID: vg0616217404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16217404 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACTCGGTCCACCGTGGACTGGCGCACCTGTGCCACCTCCATGTGGGGCCCGCCTATTGGCGCCGCTCTCTCCGATGACGTCATCCGAGGTATTTAATGC[G/A]
CAATAATTCAATTAAGGACTTTTCTGTTATAGTAATAAACACAGTGAATCTTCTAAAATTCATAGAAAATTCATCCGTGCTCCGTTTAAGCCCATTGAAG
CTTCAATGGGCTTAAACGGAGCACGGATGAATTTTCTATGAATTTTAGAAGATTCACTGTGTTTATTACTATAACAGAAAAGTCCTTAATTGAATTATTG[C/T]
GCATTAAATACCTCGGATGACGTCATCGGAGAGAGCGGCGCCAATAGGCGGGCCCCACATGGAGGTGGCACAGGTGCGCCAGTCCACGGTGGACCGAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 5.50% | 2.39% | 0.00% | NA |
| All Indica | 2759 | 87.10% | 9.00% | 3.88% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.70% | 7.10% | 9.24% | 0.00% | NA |
| Indica II | 465 | 95.50% | 2.20% | 2.37% | 0.00% | NA |
| Indica III | 913 | 91.80% | 7.60% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 79.40% | 16.20% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616217404 | G -> A | LOC_Os06g28520.1 | intron_variant ; MODIFIER | silent_mutation | Average:72.88; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616217404 | NA | 6.29E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 6.23E-06 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 3.80E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 2.80E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 1.20E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 1.84E-07 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 2.13E-06 | mr1971 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616217404 | NA | 2.09E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |