\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616217404:

Variant ID: vg0616217404 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16217404
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTCGGTCCACCGTGGACTGGCGCACCTGTGCCACCTCCATGTGGGGCCCGCCTATTGGCGCCGCTCTCTCCGATGACGTCATCCGAGGTATTTAATGC[G/A]
CAATAATTCAATTAAGGACTTTTCTGTTATAGTAATAAACACAGTGAATCTTCTAAAATTCATAGAAAATTCATCCGTGCTCCGTTTAAGCCCATTGAAG

Reverse complement sequence

CTTCAATGGGCTTAAACGGAGCACGGATGAATTTTCTATGAATTTTAGAAGATTCACTGTGTTTATTACTATAACAGAAAAGTCCTTAATTGAATTATTG[C/T]
GCATTAAATACCTCGGATGACGTCATCGGAGAGAGCGGCGCCAATAGGCGGGCCCCACATGGAGGTGGCACAGGTGCGCCAGTCCACGGTGGACCGAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 5.50% 2.39% 0.00% NA
All Indica  2759 87.10% 9.00% 3.88% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 83.70% 7.10% 9.24% 0.00% NA
Indica II  465 95.50% 2.20% 2.37% 0.00% NA
Indica III  913 91.80% 7.60% 0.66% 0.00% NA
Indica Intermediate  786 79.40% 16.20% 4.45% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616217404 G -> A LOC_Os06g28520.1 intron_variant ; MODIFIER silent_mutation Average:72.88; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616217404 NA 6.29E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 6.23E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 3.80E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 2.80E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 1.20E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 1.84E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 2.13E-06 mr1971 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616217404 NA 2.09E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251