\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616197348:

Variant ID: vg0616197348 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16197348
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGAGGAGAATCCACATACAACCCAATTTAGCCAATTGAATCGCTTTTTGAATATTTCAAATCTAGTTTTAGTCTAGTTCGTCCATCTTTATCGATCTG[C/T]
GTCATAAATCGTCCACCTTAGCTGCAAGAGGGCGAAATCCTTTTGTAGGTTTGTCTCGTAAACCTTCCGCTTATCCACGAAACGGGTAGTTATCTATTGT

Reverse complement sequence

ACAATAGATAACTACCCGTTTCGTGGATAAGCGGAAGGTTTACGAGACAAACCTACAAAAGGATTTCGCCCTCTTGCAGCTAAGGTGGACGATTTATGAC[G/A]
CAGATCGATAAAGATGGACGAACTAGACTAAAACTAGATTTGAAATATTCAAAAAGCGATTCAATTGGCTAAATTGGGTTGTATGTGGATTCTCCTCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 6.30% 2.20% 0.00% NA
All Indica  2759 86.20% 10.20% 3.62% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.80% 9.60% 8.57% 0.00% NA
Indica II  465 95.70% 2.60% 1.72% 0.00% NA
Indica III  913 91.50% 8.10% 0.44% 0.00% NA
Indica Intermediate  786 77.70% 17.60% 4.71% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616197348 C -> T LOC_Os06g28480.1 upstream_gene_variant ; 814.0bp to feature; MODIFIER silent_mutation Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0616197348 C -> T LOC_Os06g28460.1 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0616197348 C -> T LOC_Os06g28470.1 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0616197348 C -> T LOC_Os06g28470-LOC_Os06g28480 intergenic_region ; MODIFIER silent_mutation Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616197348 NA 2.38E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0616197348 NA 1.14E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 4.62E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 2.99E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 1.78E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 3.53E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 5.00E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 3.06E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 2.71E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 2.93E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 1.57E-09 mr1627 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 4.20E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 3.66E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 7.29E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 5.72E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 1.92E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 2.02E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348 NA 6.00E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251