Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616197348:

Variant ID: vg0616197348 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16197348
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGAGGAGAATCCACATACAACCCAATTTAGCCAATTGAATCGCTTTTTGAATATTTCAAATCTAGTTTTAGTCTAGTTCGTCCATCTTTATCGATCTG[C/T]
GTCATAAATCGTCCACCTTAGCTGCAAGAGGGCGAAATCCTTTTGTAGGTTTGTCTCGTAAACCTTCCGCTTATCCACGAAACGGGTAGTTATCTATTGT

Reverse complement sequence

ACAATAGATAACTACCCGTTTCGTGGATAAGCGGAAGGTTTACGAGACAAACCTACAAAAGGATTTCGCCCTCTTGCAGCTAAGGTGGACGATTTATGAC[G/A]
CAGATCGATAAAGATGGACGAACTAGACTAAAACTAGATTTGAAATATTCAAAAAGCGATTCAATTGGCTAAATTGGGTTGTATGTGGATTCTCCTCCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	6.30%	2.20%	0.00%	NA
All Indica	2759	86.20%	10.20%	3.62%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	81.80%	9.60%	8.57%	0.00%	NA
Indica II	465	95.70%	2.60%	1.72%	0.00%	NA
Indica III	913	91.50%	8.10%	0.44%	0.00%	NA
Indica Intermediate	786	77.70%	17.60%	4.71%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	88.50%	10.40%	1.04%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616197348	C -> T	LOC_Os06g28480.1	upstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0616197348	C -> T	LOC_Os06g28460.1	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0616197348	C -> T	LOC_Os06g28470.1	downstream_gene_variant ; 1835.0bp to feature; MODIFIER	silent_mutation	Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0616197348	C -> T	LOC_Os06g28470-LOC_Os06g28480	intergenic_region ; MODIFIER	silent_mutation	Average:57.65; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616197348	NA	2.38E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0616197348	NA	1.14E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	4.62E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	2.99E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	1.78E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	3.53E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	5.00E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	3.06E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	2.71E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	2.93E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	1.57E-09	mr1627	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	4.20E-07	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	3.66E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	7.29E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	5.72E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	1.92E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	2.02E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616197348	NA	6.00E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251