\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616175231:

Variant ID: vg0616175231 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16175231
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAGACTTATTCATTGGAGCAAAGGTCTCTCCAAATTAGCTTCCCTCCTCACAAATTCTAACAGAGTTATTGATTTTTTTTGATCTAATAGAGGAAAC[C/A]
GGGCAGCTCACTGTTCAGGAGTGGAATTTCAGAGAAATTGTCAAAGTTCAGATTCTCAAGCTCTTAGAGTTTAGAAATCAATATTGGAAAAAAAGGTGCA

Reverse complement sequence

TGCACCTTTTTTTCCAATATTGATTTCTAAACTCTAAGAGCTTGAGAATCTGAACTTTGACAATTTCTCTGAAATTCCACTCCTGAACAGTGAGCTGCCC[G/T]
GTTTCCTCTATTAGATCAAAAAAAATCAATAACTCTGTTAGAATTTGTGAGGAGGGAAGCTAATTTGGAGAGACCTTTGCTCCAATGAATAAGTCTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 31.90% 0.40% 31.55% NA
All Indica  2759 3.50% 51.20% 0.65% 44.65% NA
All Japonica  1512 91.10% 1.20% 0.00% 7.74% NA
Aus  269 70.30% 14.10% 0.00% 15.61% NA
Indica I  595 3.70% 82.40% 0.17% 13.78% NA
Indica II  465 2.20% 74.00% 0.43% 23.44% NA
Indica III  913 1.60% 15.30% 0.88% 82.15% NA
Indica Intermediate  786 6.40% 55.70% 0.89% 37.02% NA
Temperate Japonica  767 96.30% 1.60% 0.00% 2.09% NA
Tropical Japonica  504 82.70% 0.60% 0.00% 16.67% NA
Japonica Intermediate  241 91.70% 1.20% 0.00% 7.05% NA
VI/Aromatic  96 6.20% 11.50% 1.04% 81.25% NA
Intermediate  90 45.60% 30.00% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616175231 C -> A LOC_Os06g28430.1 upstream_gene_variant ; 2148.0bp to feature; MODIFIER silent_mutation Average:26.542; most accessible tissue: Callus, score: 67.533 N N N N
vg0616175231 C -> A LOC_Os06g28440.1 upstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:26.542; most accessible tissue: Callus, score: 67.533 N N N N
vg0616175231 C -> A LOC_Os06g28450.1 upstream_gene_variant ; 4620.0bp to feature; MODIFIER silent_mutation Average:26.542; most accessible tissue: Callus, score: 67.533 N N N N
vg0616175231 C -> A LOC_Os06g28420-LOC_Os06g28430 intergenic_region ; MODIFIER silent_mutation Average:26.542; most accessible tissue: Callus, score: 67.533 N N N N
vg0616175231 C -> DEL N N silent_mutation Average:26.542; most accessible tissue: Callus, score: 67.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616175231 NA 1.93E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.53E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 2.49E-09 2.49E-09 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 3.74E-52 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.81E-35 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 8.28E-08 8.28E-08 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 7.07E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.17E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 8.88E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 3.49E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.42E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.57E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 5.23E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 4.10E-10 4.10E-10 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 1.43E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.35E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 7.44E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 5.24E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 1.16E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 4.61E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 4.63E-06 4.89E-09 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 3.38E-06 7.57E-22 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 6.29E-08 4.11E-11 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 5.83E-07 9.48E-36 mr1477_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 5.95E-06 5.95E-06 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 3.98E-10 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 5.41E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 8.11E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 5.39E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 1.75E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.44E-23 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 4.57E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 NA 2.50E-26 mr1971_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616175231 3.73E-06 3.73E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251