Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616169045:

Variant ID: vg0616169045 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16169045
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGCCGCTTTGGTCCACGCCGACCCACGCCGTCGCCTCCCTTGGCTTCGCAAGGACGGGGAGATCCTCGGCCACTGGCCCTCTTCGCCGGAAATCCGC[T/C]
CGAGCTCCACCCCCCTCGGTCACCGGTGAGATCCTCCTAAAATTGTCGTGGTCGGTAGTCGTTTCCGGTTACCTCGCACCAGTCCTCACCTCCCTAACCC

Reverse complement sequence

GGGTTAGGGAGGTGAGGACTGGTGCGAGGTAACCGGAAACGACTACCGACCACGACAATTTTAGGAGGATCTCACCGGTGACCGAGGGGGGTGGAGCTCG[A/G]
GCGGATTTCCGGCGAAGAGGGCCAGTGGCCGAGGATCTCCCCGTCCTTGCGAAGCCAAGGGAGGCGACGGCGTGGGTCGGCGTGGACCAAAGCGGCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 31.70% 0.87% 31.27% NA
All Indica  2759 51.40% 2.90% 0.29% 45.34% NA
All Japonica  1512 1.30% 91.10% 2.18% 5.42% NA
Aus  269 82.50% 1.50% 0.00% 15.99% NA
Indica I  595 82.20% 3.20% 0.17% 14.45% NA
Indica II  465 74.20% 2.20% 0.00% 23.66% NA
Indica III  913 15.30% 1.20% 0.55% 82.91% NA
Indica Intermediate  786 56.60% 5.20% 0.25% 37.91% NA
Temperate Japonica  767 1.60% 96.30% 0.13% 1.96% NA
Tropical Japonica  504 0.80% 82.70% 5.56% 10.91% NA
Japonica Intermediate  241 1.20% 92.10% 1.66% 4.98% NA
VI/Aromatic  96 15.60% 1.00% 0.00% 83.33% NA
Intermediate  90 40.00% 35.60% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616169045 T -> C LOC_Os06g28420.1 synonymous_variant ; p.Arg165Arg; LOW synonymous_codon Average:47.676; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N
vg0616169045 T -> DEL LOC_Os06g28420.1 N frameshift_variant Average:47.676; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0616169045 T C -0.01 -0.01 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616169045 6.87E-07 2.58E-10 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 9.51E-07 1.28E-11 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.58E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 5.44E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 6.11E-08 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 6.41E-07 1.89E-11 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 3.64E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 9.03E-06 1.39E-09 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 9.39E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 6.48E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 1.78E-06 3.52E-10 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.14E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.07E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 4.43E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 3.39E-07 1.06E-11 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 3.18E-06 3.28E-13 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.64E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.17E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.18E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 8.58E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 2.75E-07 2.09E-12 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 8.72E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.47E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 3.93E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.23E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.68E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.53E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 9.18E-08 9.09E-14 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 8.85E-09 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 4.83E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 2.70E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.20E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616169045 NA 1.34E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251