\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616054262:

Variant ID: vg0616054262 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16054262
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AATCGCTGGGAAACACCTCCCAACCATGATCGCCATAGCAGGATCTTGATCTGATGAAAACAAACATGAACTCAAATGTGATGCACCAACAAAAATCATA[G/C]
ACGACAACGAAGCAAGGATAATCATTAATTTTCCAGTAATGAAGATGACATCGAGAATACATGCCTGTTAGAATGCAGCGAGGAGATGGAAAGTTCGCCA

Reverse complement sequence

TGGCGAACTTTCCATCTCCTCGCTGCATTCTAACAGGCATGTATTCTCGATGTCATCTTCATTACTGGAAAATTAATGATTATCCTTGCTTCGTTGTCGT[C/G]
TATGATTTTTGTTGGTGCATCACATTTGAGTTCATGTTTGTTTTCATCAGATCAAGATCCTGCTATGGCGATCATGGTTGGGAGGTGTTTCCCAGCGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 17.60% 0.99% 0.00% NA
All Indica  2759 99.30% 0.50% 0.18% 0.00% NA
All Japonica  1512 44.00% 53.30% 2.71% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 10.20% 88.10% 1.69% 0.00% NA
Tropical Japonica  504 90.90% 5.80% 3.37% 0.00% NA
Japonica Intermediate  241 53.50% 41.90% 4.56% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616054262 G -> C LOC_Os06g28260.1 downstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:37.59; most accessible tissue: Callus, score: 69.306 N N N N
vg0616054262 G -> C LOC_Os06g28250.1 intron_variant ; MODIFIER silent_mutation Average:37.59; most accessible tissue: Callus, score: 69.306 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616054262 NA 9.61E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 4.85E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 1.89E-11 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 1.13E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 8.77E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 3.24E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 3.47E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 1.32E-24 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 1.41E-06 NA mr1355_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 5.32E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 9.17E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 3.39E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 1.29E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 1.52E-06 NA mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 4.81E-06 NA mr1712_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 4.22E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 6.95E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 6.96E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262 NA 6.95E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251