Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616054262:

Variant ID: vg0616054262 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16054262
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AATCGCTGGGAAACACCTCCCAACCATGATCGCCATAGCAGGATCTTGATCTGATGAAAACAAACATGAACTCAAATGTGATGCACCAACAAAAATCATA[G/C]
ACGACAACGAAGCAAGGATAATCATTAATTTTCCAGTAATGAAGATGACATCGAGAATACATGCCTGTTAGAATGCAGCGAGGAGATGGAAAGTTCGCCA

Reverse complement sequence

TGGCGAACTTTCCATCTCCTCGCTGCATTCTAACAGGCATGTATTCTCGATGTCATCTTCATTACTGGAAAATTAATGATTATCCTTGCTTCGTTGTCGT[C/G]
TATGATTTTTGTTGGTGCATCACATTTGAGTTCATGTTTGTTTTCATCAGATCAAGATCCTGCTATGGCGATCATGGTTGGGAGGTGTTTCCCAGCGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	17.60%	0.99%	0.00%	NA
All Indica	2759	99.30%	0.50%	0.18%	0.00%	NA
All Japonica	1512	44.00%	53.30%	2.71%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.40%	0.25%	0.00%	NA
Temperate Japonica	767	10.20%	88.10%	1.69%	0.00%	NA
Tropical Japonica	504	90.90%	5.80%	3.37%	0.00%	NA
Japonica Intermediate	241	53.50%	41.90%	4.56%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616054262	G -> C	LOC_Os06g28260.1	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:37.59; most accessible tissue: Callus, score: 69.306	N	N	N	N
vg0616054262	G -> C	LOC_Os06g28250.1	intron_variant ; MODIFIER	silent_mutation	Average:37.59; most accessible tissue: Callus, score: 69.306	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616054262	NA	9.61E-23	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	4.85E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	1.89E-11	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	1.13E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	8.77E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	3.24E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	3.47E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	1.32E-24	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	1.41E-06	NA	mr1355_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	5.32E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	9.17E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	3.39E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	1.29E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	1.52E-06	NA	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	4.81E-06	NA	mr1712_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	4.22E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	6.95E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	6.96E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616054262	NA	6.95E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251