\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615922178:

Variant ID: vg0615922178 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15922178
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTATTTTCCCACAAGAAAAAGGTAATAGAGGGATAATTCCAACGGCTCACAACATCACGCAAACATTTCAGGGCACGCCTAATGGGCAGGTGATCGCTC[C/G]
CGTCCGCCCCCTCCCCTATACTCAGATACACTCCTCTCCCCCTTCCTCCTCCCCTACTTCTCTTCCTGCTACAGTACACCACAATTTTTTTTAAAAGAAC

Reverse complement sequence

GTTCTTTTAAAAAAAATTGTGGTGTACTGTAGCAGGAAGAGAAGTAGGGGAGGAGGAAGGGGGAGAGGAGTGTATCTGAGTATAGGGGAGGGGGCGGACG[G/C]
GAGCGATCACCTGCCCATTAGGCGTGCCCTGAAATGTTTGCGTGATGTTGTGAGCCGTTGGAATTATCCCTCTATTACCTTTTTCTTGTGGGAAAATAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.30% 0.08% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 11.50% 88.20% 0.26% 0.00% NA
Aus  269 30.10% 69.90% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 3.90% 96.00% 0.13% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 19.50% 79.30% 1.24% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615922178 C -> G LOC_Os06g28050.1 upstream_gene_variant ; 3328.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28050.3 upstream_gene_variant ; 3667.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28050.4 upstream_gene_variant ; 3328.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28060.1 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28060.3 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28060.2 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N
vg0615922178 C -> G LOC_Os06g28050-LOC_Os06g28060 intergenic_region ; MODIFIER silent_mutation Average:92.109; most accessible tissue: Minghui63 flag leaf, score: 96.004 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0615922178 C G 0.0 0.02 0.09 -0.01 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615922178 NA 2.93E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.18E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 5.83E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.06E-56 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 9.75E-46 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 6.24E-42 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 1.05E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 9.89E-53 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.01E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 1.23E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 8.31E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 3.34E-07 3.34E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 9.63E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.02E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 8.57E-60 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 5.87E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.31E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 7.04E-07 1.36E-22 mr1165_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 7.56E-09 1.39E-11 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 2.48E-55 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 1.23E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 1.38E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 9.95E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 NA 1.46E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 5.23E-06 1.53E-25 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615922178 1.08E-06 1.08E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251