Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615837393:

Variant ID: vg0615837393 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15837393
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCTAGCGACTACTATTACGTCGAAATCGTAGCTAGCTAGGACGTATAATGGATTGTAATTAATACATGACTACATATGTTTCTATATGCATGTGTACA[T/C]
ATTTTCTATAATGTAAATATATTTTGGTCATATATATATATATATATATATACATATGCATTTGCATAACATATATATGTATAAATACATATATATTATG

Reverse complement sequence

CATAATATATATGTATTTATACATATATATGTTATGCAAATGCATATGTATATATATATATATATATATATGACCAAAATATATTTACATTATAGAAAAT[A/G]
TGTACACATGCATATAGAAACATATGTAGTCATGTATTAATTACAATCCATTATACGTCCTAGCTAGCTACGATTTCGACGTAATAGTAGTCGCTAGCTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	17.70%	25.12%	25.79%	NA
All Indica	2759	2.50%	22.70%	33.31%	41.43%	NA
All Japonica	1512	91.10%	0.90%	5.89%	2.12%	NA
Aus	269	1.10%	64.30%	27.88%	6.69%	NA
Indica I	595	2.70%	5.00%	26.89%	65.38%	NA
Indica II	465	1.90%	8.60%	30.32%	59.14%	NA
Indica III	913	1.00%	47.10%	38.23%	13.69%	NA
Indica Intermediate	786	4.60%	16.20%	34.22%	45.04%	NA
Temperate Japonica	767	96.30%	0.70%	0.91%	2.09%	NA
Tropical Japonica	504	82.70%	1.60%	14.09%	1.59%	NA
Japonica Intermediate	241	91.70%	0.40%	4.56%	3.32%	NA
VI/Aromatic	96	3.10%	8.30%	85.42%	3.12%	NA
Intermediate	90	35.60%	14.40%	24.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615837393	T -> C	LOC_Os06g27910.1	upstream_gene_variant ; 3421.0bp to feature; MODIFIER	silent_mutation	Average:24.978; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0615837393	T -> C	LOC_Os06g27900.1	downstream_gene_variant ; 68.0bp to feature; MODIFIER	silent_mutation	Average:24.978; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0615837393	T -> C	LOC_Os06g27900-LOC_Os06g27910	intergenic_region ; MODIFIER	silent_mutation	Average:24.978; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0615837393	T -> DEL	N	N	silent_mutation	Average:24.978; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615837393	1.99E-06	4.43E-08	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	4.65E-08	4.65E-08	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	3.62E-06	3.62E-06	mr1065	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	1.69E-06	1.69E-06	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	1.21E-06	3.23E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	2.89E-06	7.25E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	3.24E-06	4.38E-06	mr1091	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	3.57E-07	3.57E-07	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	2.24E-07	2.24E-07	mr1234	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	3.72E-09	3.72E-09	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	3.61E-09	3.61E-09	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	1.25E-06	2.12E-09	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	7.26E-06	7.26E-06	mr1973	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	2.26E-06	2.26E-06	mr1979	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	NA	1.63E-08	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615837393	NA	2.03E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251