\
| Variant ID: vg0615774699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15774699 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 126. )
TGTGAATCCACGGGCCGCCTTGTAGAACAAACTTATGGTCTCCCTCAGCATTAAAGGTGACGATGAAAAGATTGTCCTTTAGAGATTTGTAACTCATCTC[C/T]
GCTCTGAGTCGCCAAGCTCTACCCATGTCCTCAAATAAGGCCACCTGGTTGGGGAATTTGAGCGAATAGAATCTCGCTAGGATAGTCCATTTCCTGCACA
TGTGCAGGAAATGGACTATCCTAGCGAGATTCTATTCGCTCAAATTCCCCAACCAGGTGGCCTTATTTGAGGACATGGGTAGAGCTTGGCGACTCAGAGC[G/A]
GAGATGAGTTACAAATCTCTAAAGGACAATCTTTTCATCGTCACCTTTAATGCTGAGGGAGACCATAAGTTTGTTCTACAAGGCGGCCCGTGGATTCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.10% | 0.63% | 0.00% | NA |
| All Indica | 2759 | 86.20% | 12.80% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 86.00% | 12.70% | 1.29% | 0.00% | NA |
| Indica III | 913 | 74.80% | 24.50% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 89.60% | 8.90% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615774699 | C -> T | LOC_Os06g27840.1 | synonymous_variant ; p.Ala306Ala; LOW | synonymous_codon | Average:45.388; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615774699 | 9.41E-09 | NA | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 5.51E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 3.34E-06 | NA | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 5.61E-10 | NA | mr1090 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 3.71E-06 | 1.93E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 7.11E-06 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 3.92E-06 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 7.35E-09 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 2.07E-06 | 3.93E-08 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 1.54E-06 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 9.82E-09 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 2.67E-06 | 5.33E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 9.45E-08 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 7.32E-06 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 1.70E-08 | 2.14E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 5.09E-07 | NA | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 1.36E-07 | 1.96E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 1.31E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615774699 | 2.08E-08 | 1.17E-08 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |