\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615549887:

Variant ID: vg0615549887 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15549887
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCATGGTGATAATCAACTTTTCGTTCAGATTTATGTGGATGATATCATCTTTGGTTGTTCGACTAATGCTTTGGTTGTAGATTTTGATGAGACTATCC[G/A]
CAGGGAATTTGAGATGAACATGATGGGTGAGTTATCGTACTTTTTGGGATTGCAAATTAAGCAAACACCTCAAGGTACTTTTGTGCATCAAACGAAGTAT

Reverse complement sequence

ATACTTCGTTTGATGCACAAAAGTACCTTGAGGTGTTTGCTTAATTTGCAATCCCAAAAAGTACGATAACTCACCCATCATGTTCATCTCAAATTCCCTG[C/T]
GGATAGTCTCATCAAAATCTACAACCAAAGCATTAGTCGAACAACCAAAGATGATATCATCCACATAAATCTGAACGAAAAGTTGATTATCACCATGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 1.30% 7.53% 52.92% NA
All Indica  2759 3.80% 0.10% 10.08% 86.01% NA
All Japonica  1512 91.30% 3.70% 2.91% 2.05% NA
Aus  269 70.60% 0.40% 5.20% 23.79% NA
Indica I  595 4.40% 0.00% 8.24% 87.39% NA
Indica II  465 2.60% 0.20% 12.47% 84.73% NA
Indica III  913 1.80% 0.10% 9.53% 88.61% NA
Indica Intermediate  786 6.40% 0.30% 10.69% 82.70% NA
Temperate Japonica  767 96.60% 0.10% 0.91% 2.35% NA
Tropical Japonica  504 82.50% 9.30% 6.35% 1.79% NA
Japonica Intermediate  241 92.90% 3.30% 2.07% 1.66% NA
VI/Aromatic  96 87.50% 0.00% 9.38% 3.12% NA
Intermediate  90 53.30% 1.10% 12.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615549887 G -> A LOC_Os06g27460.1 missense_variant ; p.Arg802His; MODERATE nonsynonymous_codon ; R802H Average:19.464; most accessible tissue: Zhenshan97 flower, score: 25.98 benign 0.678 TOLERATED 0.41
vg0615549887 G -> DEL LOC_Os06g27460.1 N frameshift_variant Average:19.464; most accessible tissue: Zhenshan97 flower, score: 25.98 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615549887 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 3.55E-54 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 9.31E-51 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 4.10E-06 4.10E-06 mr1275 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 3.24E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 4.02E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 4.61E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 8.98E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 4.78E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615549887 NA 4.06E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251