Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615545789:

Variant ID: vg0615545789 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15545789
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGATAACGGGCATATGTTGGCACTTGCATAGCGTCCAACAACGGCACGTTGATGTGGATCTTTTCGATCACTTCAACAAAATGAGCGAACTACTCGTCC[A/G]
CTGACGGTTTCCTACTACGCTAAGGGAATGGCAGCAATCGTGTGTCGCGGTACTCCTGCGGCACGGTCTTCTCTGGCTGAATCTCCTTGTTAGCCGAGTC

Reverse complement sequence

GACTCGGCTAACAAGGAGATTCAGCCAGAGAAGACCGTGCCGCAGGAGTACCGCGACACACGATTGCTGCCATTCCCTTAGCGTAGTAGGAAACCGTCAG[T/C]
GGACGAGTAGTTCGCTCATTTTGTTGAAGTGATCGAAAAGATCCACATCAACGTGCCGTTGTTGGACGCTATGCAAGTGCCAACATATGCCCGTTATCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	37.30%	0.13%	0.02%	NA
All Indica	2759	97.30%	2.60%	0.07%	0.04%	NA
All Japonica	1512	8.90%	91.10%	0.00%	0.00%	NA
Aus	269	30.10%	69.90%	0.00%	0.00%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.20%	0.50%	0.11%	0.11%	NA
Indica Intermediate	786	94.50%	5.30%	0.13%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	17.70%	82.30%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	85.40%	3.12%	0.00%	NA
Intermediate	90	48.90%	50.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615545789	A -> G	LOC_Os06g27450.1	upstream_gene_variant ; 137.0bp to feature; MODIFIER	silent_mutation	Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0615545789	A -> G	LOC_Os06g27460.1	upstream_gene_variant ; 349.0bp to feature; MODIFIER	silent_mutation	Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0615545789	A -> G	LOC_Os06g27450-LOC_Os06g27460	intergenic_region ; MODIFIER	silent_mutation	Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0615545789	A -> DEL	N	N	silent_mutation	Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615545789	NA	2.41E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	NA	1.29E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	NA	7.51E-14	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	1.35E-06	1.35E-06	mr1396	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	NA	1.77E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	NA	9.05E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615545789	NA	7.83E-22	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251