\
| Variant ID: vg0615545789 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15545789 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGATAACGGGCATATGTTGGCACTTGCATAGCGTCCAACAACGGCACGTTGATGTGGATCTTTTCGATCACTTCAACAAAATGAGCGAACTACTCGTCC[A/G]
CTGACGGTTTCCTACTACGCTAAGGGAATGGCAGCAATCGTGTGTCGCGGTACTCCTGCGGCACGGTCTTCTCTGGCTGAATCTCCTTGTTAGCCGAGTC
GACTCGGCTAACAAGGAGATTCAGCCAGAGAAGACCGTGCCGCAGGAGTACCGCGACACACGATTGCTGCCATTCCCTTAGCGTAGTAGGAAACCGTCAG[T/C]
GGACGAGTAGTTCGCTCATTTTGTTGAAGTGATCGAAAAGATCCACATCAACGTGCCGTTGTTGGACGCTATGCAAGTGCCAACATATGCCCGTTATCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.30% | 0.13% | 0.02% | NA |
| All Indica | 2759 | 97.30% | 2.60% | 0.07% | 0.04% | NA |
| All Japonica | 1512 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.10% | 69.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.50% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 94.50% | 5.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 85.40% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615545789 | A -> G | LOC_Os06g27450.1 | upstream_gene_variant ; 137.0bp to feature; MODIFIER | silent_mutation | Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0615545789 | A -> G | LOC_Os06g27460.1 | upstream_gene_variant ; 349.0bp to feature; MODIFIER | silent_mutation | Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0615545789 | A -> G | LOC_Os06g27450-LOC_Os06g27460 | intergenic_region ; MODIFIER | silent_mutation | Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0615545789 | A -> DEL | N | N | silent_mutation | Average:47.782; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615545789 | NA | 2.41E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | NA | 1.29E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | NA | 7.51E-14 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | 1.35E-06 | 1.35E-06 | mr1396 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | NA | 1.77E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | NA | 9.05E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615545789 | NA | 7.83E-22 | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |