Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615398593:

Variant ID: vg0615398593 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15398593
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGACTCAAAAGAAGCAAGAATCATTTGTTTTATCTGTGATGAACAAGGGCACTATGCAAGGAAATGTCCTCAGCGGAAAAGAAAAGCACCAATGCGAA[C/T]
CGAAGATGAAGTCCGTAAGATGACCATTACCGGCACAGAATGGCCTCCACCAGGAATGACAAAACGTCAGAGAGGAAATTTCTTTCATGGTGCACCACAG

Reverse complement sequence

CTGTGGTGCACCATGAAAGAAATTTCCTCTCTGACGTTTTGTCATTCCTGGTGGAGGCCATTCTGTGCCGGTAATGGTCATCTTACGGACTTCATCTTCG[G/A]
TTCGCATTGGTGCTTTTCTTTTCCGCTGAGGACATTTCCTTGCATAGTGCCCTTGTTCATCACAGATAAAACAAATGATTCTTGCTTCTTTTGAGTCCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	7.70%	0.99%	0.38%	NA
All Indica	2759	86.90%	12.40%	0.69%	0.04%	NA
All Japonica	1512	99.10%	0.80%	0.07%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	88.00%	11.40%	0.65%	0.00%	NA
Indica III	913	74.90%	24.30%	0.66%	0.11%	NA
Indica Intermediate	786	90.30%	8.50%	1.15%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	58.30%	1.00%	26.04%	14.58%	NA
Intermediate	90	85.60%	10.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615398593	C -> T	LOC_Os06g26310.1	upstream_gene_variant ; 567.0bp to feature; MODIFIER	silent_mutation	Average:44.538; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0615398593	C -> T	LOC_Os06g26300.1	downstream_gene_variant ; 502.0bp to feature; MODIFIER	silent_mutation	Average:44.538; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0615398593	C -> T	LOC_Os06g26300-LOC_Os06g26310	intergenic_region ; MODIFIER	silent_mutation	Average:44.538; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0615398593	C -> DEL	N	N	silent_mutation	Average:44.538; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615398593	4.25E-08	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	5.06E-07	NA	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	8.45E-08	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	3.62E-07	1.11E-09	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	4.90E-06	NA	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	3.46E-07	NA	mr1110	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	9.21E-08	NA	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	2.42E-08	NA	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	6.65E-07	1.73E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.63E-07	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	3.55E-06	NA	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.64E-08	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.28E-07	7.38E-11	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	5.39E-08	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	7.02E-09	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	3.06E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.03E-09	1.16E-09	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	2.34E-06	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.36E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	7.13E-07	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	2.29E-08	NA	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.65E-08	1.01E-09	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	2.85E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.69E-06	NA	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	3.79E-07	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.79E-07	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615398593	1.54E-09	1.01E-11	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251