\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615397520:

Variant ID: vg0615397520 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15397520
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTTTGGACCTGCACTGAATTTAAGCAGATCATCCAGGCCAGTGTGTGTTTTTCACATCAACACGCTTTTGGCACGCTTAGTAGGACACGACAAATGA[C/T]
GAACATGTTAGCAGAAAAGCAATCCCCGTCGTCGACAAGCAAGCCGCCGATTCCCCCGAAAACCAAGCTTCCCAAGCCTCCAGGGACTAATAAGTCATCA

Reverse complement sequence

TGATGACTTATTAGTCCCTGGAGGCTTGGGAAGCTTGGTTTTCGGGGGAATCGGCGGCTTGCTTGTCGACGACGGGGATTGCTTTTCTGCTAACATGTTC[G/A]
TCATTTGTCGTGTCCTACTAAGCGTGCCAAAAGCGTGTTGATGTGAAAAACACACACTGGCCTGGATGATCTGCTTAAATTCAGTGCAGGTCCAAAATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 7.40% 0.99% 1.50% NA
All Indica  2759 93.50% 5.10% 1.30% 0.07% NA
All Japonica  1512 99.20% 0.50% 0.13% 0.13% NA
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.84% 0.00% NA
Indica II  465 89.00% 8.80% 2.15% 0.00% NA
Indica III  913 94.00% 5.90% 0.00% 0.11% NA
Indica Intermediate  786 91.30% 5.90% 2.67% 0.13% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 21.90% 4.20% 8.33% 65.62% NA
Intermediate  90 80.00% 14.40% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615397520 C -> T LOC_Os06g26300.1 upstream_gene_variant ; 182.0bp to feature; MODIFIER silent_mutation Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0615397520 C -> T LOC_Os06g26310.1 upstream_gene_variant ; 1640.0bp to feature; MODIFIER silent_mutation Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0615397520 C -> T LOC_Os06g26290-LOC_Os06g26300 intergenic_region ; MODIFIER silent_mutation Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0615397520 C -> DEL N N silent_mutation Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615397520 NA 2.71E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 NA 1.80E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 3.23E-06 NA mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 7.88E-07 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 2.85E-07 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 2.06E-06 NA mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 1.91E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520 3.06E-06 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251