\
| Variant ID: vg0615397520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15397520 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )
AGATTTTGGACCTGCACTGAATTTAAGCAGATCATCCAGGCCAGTGTGTGTTTTTCACATCAACACGCTTTTGGCACGCTTAGTAGGACACGACAAATGA[C/T]
GAACATGTTAGCAGAAAAGCAATCCCCGTCGTCGACAAGCAAGCCGCCGATTCCCCCGAAAACCAAGCTTCCCAAGCCTCCAGGGACTAATAAGTCATCA
TGATGACTTATTAGTCCCTGGAGGCTTGGGAAGCTTGGTTTTCGGGGGAATCGGCGGCTTGCTTGTCGACGACGGGGATTGCTTTTCTGCTAACATGTTC[G/A]
TCATTTGTCGTGTCCTACTAAGCGTGCCAAAAGCGTGTTGATGTGAAAAACACACACTGGCCTGGATGATCTGCTTAAATTCAGTGCAGGTCCAAAATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 7.40% | 0.99% | 1.50% | NA |
| All Indica | 2759 | 93.50% | 5.10% | 1.30% | 0.07% | NA |
| All Japonica | 1512 | 99.20% | 0.50% | 0.13% | 0.13% | NA |
| Aus | 269 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 89.00% | 8.80% | 2.15% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.90% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 91.30% | 5.90% | 2.67% | 0.13% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 21.90% | 4.20% | 8.33% | 65.62% | NA |
| Intermediate | 90 | 80.00% | 14.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615397520 | C -> T | LOC_Os06g26300.1 | upstream_gene_variant ; 182.0bp to feature; MODIFIER | silent_mutation | Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg0615397520 | C -> T | LOC_Os06g26310.1 | upstream_gene_variant ; 1640.0bp to feature; MODIFIER | silent_mutation | Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg0615397520 | C -> T | LOC_Os06g26290-LOC_Os06g26300 | intergenic_region ; MODIFIER | silent_mutation | Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg0615397520 | C -> DEL | N | N | silent_mutation | Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615397520 | NA | 2.71E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | NA | 1.80E-11 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 3.23E-06 | NA | mr1062_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 7.88E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 2.85E-07 | NA | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 2.06E-06 | NA | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 1.91E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615397520 | 3.06E-06 | NA | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |