Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615397520:

Variant ID: vg0615397520 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15397520
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AGATTTTGGACCTGCACTGAATTTAAGCAGATCATCCAGGCCAGTGTGTGTTTTTCACATCAACACGCTTTTGGCACGCTTAGTAGGACACGACAAATGA[C/T]
GAACATGTTAGCAGAAAAGCAATCCCCGTCGTCGACAAGCAAGCCGCCGATTCCCCCGAAAACCAAGCTTCCCAAGCCTCCAGGGACTAATAAGTCATCA

Reverse complement sequence

TGATGACTTATTAGTCCCTGGAGGCTTGGGAAGCTTGGTTTTCGGGGGAATCGGCGGCTTGCTTGTCGACGACGGGGATTGCTTTTCTGCTAACATGTTC[G/A]
TCATTTGTCGTGTCCTACTAAGCGTGCCAAAAGCGTGTTGATGTGAAAAACACACACTGGCCTGGATGATCTGCTTAAATTCAGTGCAGGTCCAAAATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	7.40%	0.99%	1.50%	NA
All Indica	2759	93.50%	5.10%	1.30%	0.07%	NA
All Japonica	1512	99.20%	0.50%	0.13%	0.13%	NA
Aus	269	31.20%	68.80%	0.00%	0.00%	NA
Indica I	595	99.20%	0.00%	0.84%	0.00%	NA
Indica II	465	89.00%	8.80%	2.15%	0.00%	NA
Indica III	913	94.00%	5.90%	0.00%	0.11%	NA
Indica Intermediate	786	91.30%	5.90%	2.67%	0.13%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.00%	0.83%	NA
VI/Aromatic	96	21.90%	4.20%	8.33%	65.62%	NA
Intermediate	90	80.00%	14.40%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615397520	C -> T	LOC_Os06g26300.1	upstream_gene_variant ; 182.0bp to feature; MODIFIER	silent_mutation	Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0615397520	C -> T	LOC_Os06g26310.1	upstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0615397520	C -> T	LOC_Os06g26290-LOC_Os06g26300	intergenic_region ; MODIFIER	silent_mutation	Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0615397520	C -> DEL	N	N	silent_mutation	Average:53.173; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615397520	NA	2.71E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	NA	1.80E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	3.23E-06	NA	mr1062_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	7.88E-07	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	2.85E-07	NA	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	2.06E-06	NA	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	1.91E-06	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615397520	3.06E-06	NA	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251