\
| Variant ID: vg0615347149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15347149 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGTACTGCCTTAGCCCATCGAAGGCGGCTTGACACTCAGGTGTCCAATTGAGTTTGCCGGCCCCTTGGAGCATCTTGAAAAATGATAAATCTCTTTCGG[T/C]
TGCTCTTGGGAGCAACTCCTTAACTCATTTTCGCCCCTAGCCCTTGTCGCCGTACCTCGCTGGTACTGTGGCGAAAGGCGTGGGTGTGGCGAAACCTGTT
AACAGGTTTCGCCACACCCACGCCTTTCGCCACAGTACCAGCGAGGTACGGCGACAAGGGCTAGGGGCGAAAATGAGTTAAGGAGTTGCTCCCAAGAGCA[A/G]
CCGAAAGAGATTTATCATTTTTCAAGATGCTCCAAGGGGCCGGCAAACTCAATTGGACACCTGAGTGTCAAGCCGCCTTCGATGGGCTAAGGCAGTACCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 28.90% | 2.37% | 4.34% | NA |
| All Indica | 2759 | 96.80% | 2.90% | 0.25% | 0.04% | NA |
| All Japonica | 1512 | 9.10% | 82.60% | 1.52% | 6.75% | NA |
| Aus | 269 | 33.10% | 2.20% | 28.62% | 36.06% | NA |
| Indica I | 595 | 95.30% | 4.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.20% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 3.80% | 80.20% | 3.00% | 13.04% | NA |
| Tropical Japonica | 504 | 17.70% | 82.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 60.00% | 32.20% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615347149 | T -> C | LOC_Os06g26234.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.849; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0615347149 | T -> C | LOC_Os06g26234.2 | intron_variant ; MODIFIER | silent_mutation | Average:37.849; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0615347149 | T -> C | LOC_Os06g26234.3 | intron_variant ; MODIFIER | silent_mutation | Average:37.849; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0615347149 | T -> DEL | N | N | silent_mutation | Average:37.849; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615347149 | 7.84E-06 | 7.84E-06 | mr1275 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 2.99E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 7.34E-18 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 4.85E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 4.32E-08 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | 1.18E-06 | NA | mr1172_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 5.94E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 1.20E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 2.84E-07 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 1.58E-09 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 8.06E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 1.94E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 5.22E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 6.34E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | 8.54E-07 | 2.82E-10 | mr1765_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 6.85E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | 1.71E-06 | 1.71E-06 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615347149 | NA | 4.11E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |