Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0615329006:

Variant ID: vg0615329006 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15329006
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAATATCATCGTCATGACATCGAGTAATTGCATAAGCAAACATTATACCCGCACCAAAGCATATCCCAGATAAGCTAGCCATATATTCAGTATAACAT[A/G]
AACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATGTATAAAGAAGAGTATTCTAATAAAAGTACAAAGCTTACAAAAGA

Reverse complement sequence

TCTTTTGTAAGCTTTGTACTTTTATTAGAATACTCTTCTTTATACATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTT[T/C]
ATGTTATACTGAATATATGGCTAGCTTATCTGGGATATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTACTCGATGTCATGACGATGATATTTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	31.10%	0.66%	1.97%	NA
All Indica	2759	93.80%	2.20%	0.98%	3.01%	NA
All Japonica	1512	8.80%	90.80%	0.00%	0.40%	NA
Aus	269	97.40%	1.10%	0.74%	0.74%	NA
Indica I	595	92.90%	2.50%	1.01%	3.53%	NA
Indica II	465	96.60%	1.30%	0.43%	1.72%	NA
Indica III	913	95.00%	0.70%	1.64%	2.74%	NA
Indica Intermediate	786	91.50%	4.30%	0.51%	3.69%	NA
Temperate Japonica	767	3.70%	96.20%	0.00%	0.13%	NA
Tropical Japonica	504	17.10%	82.10%	0.00%	0.79%	NA
Japonica Intermediate	241	7.90%	91.70%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	34.40%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615329006	A -> G	LOC_Os06g26190.1	upstream_gene_variant ; 2555.0bp to feature; MODIFIER	silent_mutation	Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0615329006	A -> G	LOC_Os06g26210.1	downstream_gene_variant ; 725.0bp to feature; MODIFIER	silent_mutation	Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0615329006	A -> G	LOC_Os06g26190-LOC_Os06g26210	intergenic_region ; MODIFIER	silent_mutation	Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0615329006	A -> DEL	N	N	silent_mutation	Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615329006	NA	2.62E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615329006	1.96E-06	1.96E-06	mr1972	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615329006	NA	4.64E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251