\
| Variant ID: vg0615329006 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15329006 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
TCAAATATCATCGTCATGACATCGAGTAATTGCATAAGCAAACATTATACCCGCACCAAAGCATATCCCAGATAAGCTAGCCATATATTCAGTATAACAT[A/G]
AACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATGTATAAAGAAGAGTATTCTAATAAAAGTACAAAGCTTACAAAAGA
TCTTTTGTAAGCTTTGTACTTTTATTAGAATACTCTTCTTTATACATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTT[T/C]
ATGTTATACTGAATATATGGCTAGCTTATCTGGGATATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTACTCGATGTCATGACGATGATATTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 31.10% | 0.66% | 1.97% | NA |
| All Indica | 2759 | 93.80% | 2.20% | 0.98% | 3.01% | NA |
| All Japonica | 1512 | 8.80% | 90.80% | 0.00% | 0.40% | NA |
| Aus | 269 | 97.40% | 1.10% | 0.74% | 0.74% | NA |
| Indica I | 595 | 92.90% | 2.50% | 1.01% | 3.53% | NA |
| Indica II | 465 | 96.60% | 1.30% | 0.43% | 1.72% | NA |
| Indica III | 913 | 95.00% | 0.70% | 1.64% | 2.74% | NA |
| Indica Intermediate | 786 | 91.50% | 4.30% | 0.51% | 3.69% | NA |
| Temperate Japonica | 767 | 3.70% | 96.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 17.10% | 82.10% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 7.90% | 91.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 34.40% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615329006 | A -> G | LOC_Os06g26190.1 | upstream_gene_variant ; 2555.0bp to feature; MODIFIER | silent_mutation | Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0615329006 | A -> G | LOC_Os06g26210.1 | downstream_gene_variant ; 725.0bp to feature; MODIFIER | silent_mutation | Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0615329006 | A -> G | LOC_Os06g26190-LOC_Os06g26210 | intergenic_region ; MODIFIER | silent_mutation | Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0615329006 | A -> DEL | N | N | silent_mutation | Average:42.56; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615329006 | NA | 2.62E-09 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615329006 | 1.96E-06 | 1.96E-06 | mr1972 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615329006 | NA | 4.64E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |