Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615292681:

Variant ID: vg0615292681 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15292681
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AACTGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAACGCTACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACAGTGCATTGAGTC[A/G]
ATTTATTAAAGTGGGACTAATCACGGTGAATCTGGTCGATCGCCCATAACCGCGGGCACGGCTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACAACT

Reverse complement sequence

AGTTGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGCCGTGCCCGCGGTTATGGGCGATCGACCAGATTCACCGTGATTAGTCCCACTTTAATAAAT[T/C]
GACTCAATGCACTGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTAGCGTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACAGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	31.00%	0.00%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.00%	0.00%	NA
All Japonica	1512	9.20%	90.80%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.40%	4.60%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	17.90%	82.10%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615292681	A -> G	LOC_Os06g26140.1	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:47.264; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0615292681	A -> G	LOC_Os06g26130.1	downstream_gene_variant ; 524.0bp to feature; MODIFIER	silent_mutation	Average:47.264; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0615292681	A -> G	LOC_Os06g26150.1	downstream_gene_variant ; 3493.0bp to feature; MODIFIER	silent_mutation	Average:47.264; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0615292681	A -> G	LOC_Os06g26130-LOC_Os06g26140	intergenic_region ; MODIFIER	silent_mutation	Average:47.264; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615292681	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	9.92E-11	9.94E-76	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	4.52E-06	4.15E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	2.64E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	2.53E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	6.33E-06	6.33E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	2.17E-08	1.09E-40	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	7.99E-06	5.97E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	4.79E-07	4.79E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	2.57E-66	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	9.28E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	1.66E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	3.45E-06	6.96E-29	mr1631	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	4.07E-10	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	1.26E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	3.01E-07	6.20E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	NA	4.61E-08	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615292681	6.67E-06	4.94E-09	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251