\
| Variant ID: vg0615270938 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15270938 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGGCTCTGGGACAGTCAGCGAGGACTTGGGACTTGATCGTGGTGCGGGCGACAAAGTGTAGGCCGAAAGGTGACAGCTCAGCAGTCCATTTCCTTAGGC[G/A,C]
CCCCGTAGTTTCTTTTCCTCGATGATACTGCGAAGGTACCACGATTTTGTGGGCTTGGAAATAGTGTTTGAGCTTTGATGAAGCCATCACCAGGGTGTAA
TTACACCCTGGTGATGGCTTCATCAAAGCTCAAACACTATTTCCAAGCCCACAAAATCGTGGTACCTTCGCAGTATCATCGAGGAAAAGAAACTACGGGG[C/T,G]
GCCTAAGGAAATGGACTGCTGAGCTGTCACCTTTCGGCCTACACTTTGTCGCCCGCACCACGATCAAGTCCCAAGTCCTCGCTGACTGTCCCAGAGCCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 31.60% | 1.10% | 28.12% | C: 0.04% |
| All Indica | 2759 | 5.30% | 50.90% | 1.20% | 42.66% | C: 0.04% |
| All Japonica | 1512 | 96.50% | 1.50% | 0.60% | 1.46% | NA |
| Aus | 269 | 73.20% | 11.20% | 2.97% | 12.27% | C: 0.37% |
| Indica I | 595 | 7.20% | 82.00% | 0.17% | 10.59% | NA |
| Indica II | 465 | 3.70% | 74.20% | 0.65% | 21.51% | NA |
| Indica III | 913 | 2.30% | 15.20% | 1.42% | 81.05% | NA |
| Indica Intermediate | 786 | 8.10% | 54.80% | 2.04% | 34.86% | C: 0.13% |
| Temperate Japonica | 767 | 95.30% | 2.10% | 0.78% | 1.83% | NA |
| Tropical Japonica | 504 | 98.60% | 0.60% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 6.20% | 12.50% | 0.00% | 81.25% | NA |
| Intermediate | 90 | 47.80% | 28.90% | 2.22% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615270938 | G -> C | LOC_Os06g26090.1 | upstream_gene_variant ; 265.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> C | LOC_Os06g26080.1 | downstream_gene_variant ; 3537.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> C | LOC_Os06g26100.1 | downstream_gene_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> C | LOC_Os06g26110.1 | downstream_gene_variant ; 4763.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> C | LOC_Os06g26090-LOC_Os06g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> A | LOC_Os06g26090.1 | upstream_gene_variant ; 265.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> A | LOC_Os06g26080.1 | downstream_gene_variant ; 3537.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> A | LOC_Os06g26100.1 | downstream_gene_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> A | LOC_Os06g26110.1 | downstream_gene_variant ; 4763.0bp to feature; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> A | LOC_Os06g26090-LOC_Os06g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0615270938 | G -> DEL | N | N | silent_mutation | Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615270938 | NA | 3.35E-35 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.62E-33 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.98E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.63E-30 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.15E-17 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | 7.00E-06 | 6.45E-06 | mr1256 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 2.73E-09 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 8.25E-24 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.74E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.07E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.77E-34 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.21E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 9.01E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 3.89E-22 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 1.62E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 8.15E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 2.95E-46 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615270938 | NA | 2.05E-22 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |