\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615270938:

Variant ID: vg0615270938 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15270938
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGCTCTGGGACAGTCAGCGAGGACTTGGGACTTGATCGTGGTGCGGGCGACAAAGTGTAGGCCGAAAGGTGACAGCTCAGCAGTCCATTTCCTTAGGC[G/A,C]
CCCCGTAGTTTCTTTTCCTCGATGATACTGCGAAGGTACCACGATTTTGTGGGCTTGGAAATAGTGTTTGAGCTTTGATGAAGCCATCACCAGGGTGTAA

Reverse complement sequence

TTACACCCTGGTGATGGCTTCATCAAAGCTCAAACACTATTTCCAAGCCCACAAAATCGTGGTACCTTCGCAGTATCATCGAGGAAAAGAAACTACGGGG[C/T,G]
GCCTAAGGAAATGGACTGCTGAGCTGTCACCTTTCGGCCTACACTTTGTCGCCCGCACCACGATCAAGTCCCAAGTCCTCGCTGACTGTCCCAGAGCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 31.60% 1.10% 28.12% C: 0.04%
All Indica  2759 5.30% 50.90% 1.20% 42.66% C: 0.04%
All Japonica  1512 96.50% 1.50% 0.60% 1.46% NA
Aus  269 73.20% 11.20% 2.97% 12.27% C: 0.37%
Indica I  595 7.20% 82.00% 0.17% 10.59% NA
Indica II  465 3.70% 74.20% 0.65% 21.51% NA
Indica III  913 2.30% 15.20% 1.42% 81.05% NA
Indica Intermediate  786 8.10% 54.80% 2.04% 34.86% C: 0.13%
Temperate Japonica  767 95.30% 2.10% 0.78% 1.83% NA
Tropical Japonica  504 98.60% 0.60% 0.00% 0.79% NA
Japonica Intermediate  241 95.90% 1.20% 1.24% 1.66% NA
VI/Aromatic  96 6.20% 12.50% 0.00% 81.25% NA
Intermediate  90 47.80% 28.90% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615270938 G -> C LOC_Os06g26090.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> C LOC_Os06g26080.1 downstream_gene_variant ; 3537.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> C LOC_Os06g26100.1 downstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> C LOC_Os06g26110.1 downstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> C LOC_Os06g26090-LOC_Os06g26100 intergenic_region ; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> A LOC_Os06g26090.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> A LOC_Os06g26080.1 downstream_gene_variant ; 3537.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> A LOC_Os06g26100.1 downstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> A LOC_Os06g26110.1 downstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> A LOC_Os06g26090-LOC_Os06g26100 intergenic_region ; MODIFIER silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0615270938 G -> DEL N N silent_mutation Average:30.152; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615270938 NA 3.35E-35 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.62E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.98E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.63E-30 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.15E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 7.00E-06 6.45E-06 mr1256 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 2.73E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 8.25E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.74E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.07E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.77E-34 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.21E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 9.01E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 3.89E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 1.62E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 8.15E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 2.95E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615270938 NA 2.05E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251