Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615249086:

Variant ID: vg0615249086 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15249086
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGAACACTTGTTCAGAAGTACAAAGTGAAGGTAGTTGCTGATGATCCTGGGACCAATTCTTCCAAGGATGAAGAAGGGAAACAGTCTCCAGATGGCTC[G/A]
GCTCAATCGAGTGACAAATGTGCTACAGATGGTTCTCTGGGAAATCAAGGTGACAACTCTCAAGGAGTACACGGAGTTCAAGGTGATGGTGCTAAGGGAG

Reverse complement sequence

CTCCCTTAGCACCATCACCTTGAACTCCGTGTACTCCTTGAGAGTTGTCACCTTGATTTCCCAGAGAACCATCTGTAGCACATTTGTCACTCGATTGAGC[C/T]
GAGCCATCTGGAGACTGTTTCCCTTCTTCATCCTTGGAAGAATTGGTCCCAGGATCATCAGCAACTACCTTCACTTTGTACTTCTGAACAAGTGTTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.90%	31.60%	12.19%	13.27%	NA
All Indica	2759	7.60%	51.10%	20.15%	21.20%	NA
All Japonica	1512	97.80%	1.10%	0.33%	0.79%	NA
Aus	269	75.50%	11.90%	3.35%	9.29%	NA
Indica I	595	8.40%	82.40%	4.20%	5.04%	NA
Indica II	465	6.70%	74.20%	6.45%	12.69%	NA
Indica III	913	3.90%	15.20%	43.59%	37.24%	NA
Indica Intermediate	786	11.70%	55.30%	13.10%	19.85%	NA
Temperate Japonica	767	97.00%	1.40%	0.52%	1.04%	NA
Tropical Japonica	504	98.60%	0.60%	0.20%	0.60%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	58.90%	28.90%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615249086	G -> A	LOC_Os06g26060.1	synonymous_variant ; p.Ser51Ser; LOW	synonymous_codon	Average:21.564; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0615249086	G -> DEL	LOC_Os06g26060.1	N	frameshift_variant	Average:21.564; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615249086	NA	1.07E-56	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	6.01E-45	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.79E-08	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.87E-41	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	4.88E-47	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	8.91E-46	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	3.25E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.23E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	4.92E-47	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	4.23E-42	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.54E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.65E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.67E-64	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.53E-09	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.54E-50	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.04E-57	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	2.33E-60	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	4.41E-37	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.01E-59	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	8.27E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.44E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	6.41E-08	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	6.84E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.45E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	1.21E-06	1.93E-20	mr1744_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	5.61E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615249086	NA	1.64E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251