Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615245670:

Variant ID: vg0615245670 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15245670
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTACCATCTTGAGTAATTGATAAATGGAATGATCTCGTTTCCAGTCCTTCTTGCTTCTCTGTTAGACTCATGGGATTTTTATGAATTTTCGCAAACCA[A/G]
CTCTTTTCCTAATATTGACTTTCTCTCTTGTCTCTCAAAGATATATATTTTCTTTTTGGATCCTCACCAAGGCAAAATGTGCCAGAATTCACCCCTATTC

Reverse complement sequence

GAATAGGGGTGAATTCTGGCACATTTTGCCTTGGTGAGGATCCAAAAAGAAAATATATATCTTTGAGAGACAAGAGAGAAAGTCAATATTAGGAAAAGAG[T/C]
TGGTTTGCGAAAATTCATAAAAATCCCATGAGTCTAACAGAGAAGCAAGAAGGACTGGAAACGAGATCATTCCATTTATCAATTACTCAAGATGGTAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.40%	32.60%	0.32%	25.67%	NA
All Indica	2759	53.10%	4.70%	0.51%	41.68%	NA
All Japonica	1512	7.90%	90.90%	0.00%	1.19%	NA
Aus	269	85.90%	1.50%	0.00%	12.64%	NA
Indica I	595	86.10%	4.20%	0.17%	9.58%	NA
Indica II	465	75.90%	4.50%	0.22%	19.35%	NA
Indica III	913	15.80%	2.50%	0.77%	80.94%	NA
Indica Intermediate	786	58.10%	7.60%	0.64%	33.59%	NA
Temperate Japonica	767	2.00%	96.50%	0.00%	1.56%	NA
Tropical Japonica	504	17.10%	82.10%	0.00%	0.79%	NA
Japonica Intermediate	241	7.50%	91.70%	0.00%	0.83%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	37.80%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615245670	A -> G	LOC_Os06g26050.1	upstream_gene_variant ; 2903.0bp to feature; MODIFIER	silent_mutation	Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0615245670	A -> G	LOC_Os06g26060.1	upstream_gene_variant ; 3264.0bp to feature; MODIFIER	silent_mutation	Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0615245670	A -> G	LOC_Os06g26040.1	downstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0615245670	A -> G	LOC_Os06g26050-LOC_Os06g26060	intergenic_region ; MODIFIER	silent_mutation	Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0615245670	A -> DEL	N	N	silent_mutation	Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615245670	NA	3.72E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.68E-08	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	5.25E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.54E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	6.28E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	2.63E-08	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	3.17E-06	2.34E-09	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	4.43E-06	8.97E-09	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	4.77E-06	2.90E-09	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	4.92E-10	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	6.49E-25	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.62E-06	mr1888	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.03E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	7.82E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.82E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	3.23E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	6.24E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	6.96E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	2.09E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.66E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	1.48E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	4.97E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670	NA	3.10E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251