\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615245670:

Variant ID: vg0615245670 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15245670
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTACCATCTTGAGTAATTGATAAATGGAATGATCTCGTTTCCAGTCCTTCTTGCTTCTCTGTTAGACTCATGGGATTTTTATGAATTTTCGCAAACCA[A/G]
CTCTTTTCCTAATATTGACTTTCTCTCTTGTCTCTCAAAGATATATATTTTCTTTTTGGATCCTCACCAAGGCAAAATGTGCCAGAATTCACCCCTATTC

Reverse complement sequence

GAATAGGGGTGAATTCTGGCACATTTTGCCTTGGTGAGGATCCAAAAAGAAAATATATATCTTTGAGAGACAAGAGAGAAAGTCAATATTAGGAAAAGAG[T/C]
TGGTTTGCGAAAATTCATAAAAATCCCATGAGTCTAACAGAGAAGCAAGAAGGACTGGAAACGAGATCATTCCATTTATCAATTACTCAAGATGGTAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 32.60% 0.32% 25.67% NA
All Indica  2759 53.10% 4.70% 0.51% 41.68% NA
All Japonica  1512 7.90% 90.90% 0.00% 1.19% NA
Aus  269 85.90% 1.50% 0.00% 12.64% NA
Indica I  595 86.10% 4.20% 0.17% 9.58% NA
Indica II  465 75.90% 4.50% 0.22% 19.35% NA
Indica III  913 15.80% 2.50% 0.77% 80.94% NA
Indica Intermediate  786 58.10% 7.60% 0.64% 33.59% NA
Temperate Japonica  767 2.00% 96.50% 0.00% 1.56% NA
Tropical Japonica  504 17.10% 82.10% 0.00% 0.79% NA
Japonica Intermediate  241 7.50% 91.70% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 48.90% 37.80% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615245670 A -> G LOC_Os06g26050.1 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0615245670 A -> G LOC_Os06g26060.1 upstream_gene_variant ; 3264.0bp to feature; MODIFIER silent_mutation Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0615245670 A -> G LOC_Os06g26040.1 downstream_gene_variant ; 4359.0bp to feature; MODIFIER silent_mutation Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0615245670 A -> G LOC_Os06g26050-LOC_Os06g26060 intergenic_region ; MODIFIER silent_mutation Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0615245670 A -> DEL N N silent_mutation Average:17.942; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615245670 NA 3.72E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.68E-08 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 5.25E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.54E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 6.28E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 2.63E-08 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 3.17E-06 2.34E-09 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 4.43E-06 8.97E-09 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 4.77E-06 2.90E-09 mr1619 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 4.92E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 6.49E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.62E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.03E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 7.82E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.82E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 3.23E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 6.24E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 6.96E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 2.09E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.66E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 1.48E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 4.97E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245670 NA 3.10E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251