Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615245465:

Variant ID: vg0615245465 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15245465
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTGAATGTTTTATTATCTGGACTTTATGGAGATGTTGGCGGTATAGAATCAGCATTTAACAGCCGCCAACAAAACCCTCCACACTTAGCTCTTTGCT[T/C]
GTCCCTGAGTAAAGGTTAGTGTAGAATGAATTCCTTCAAGATACGAATCAAGCATATAAATCATTCACAACCATACCTGCACCTGTGAACTTTATCAGTG

Reverse complement sequence

CACTGATAAAGTTCACAGGTGCAGGTATGGTTGTGAATGATTTATATGCTTGATTCGTATCTTGAAGGAATTCATTCTACACTAACCTTTACTCAGGGAC[A/G]
AGCAAAGAGCTAAGTGTGGAGGGTTTTGTTGGCGGCTGTTAAATGCTGATTCTATACCGCCAACATCTCCATAAAGTCCAGATAATAAAACATTCAACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.90%	41.30%	9.94%	3.87%	NA
All Indica	2759	25.30%	53.00%	15.84%	5.84%	NA
All Japonica	1512	91.00%	7.80%	0.86%	0.33%	NA
Aus	269	2.60%	85.90%	5.58%	5.95%	NA
Indica I	595	6.10%	85.90%	6.72%	1.34%	NA
Indica II	465	11.60%	75.70%	8.17%	4.52%	NA
Indica III	913	48.40%	15.80%	26.94%	8.87%	NA
Indica Intermediate	786	21.20%	57.90%	14.38%	6.49%	NA
Temperate Japonica	767	96.60%	1.80%	1.17%	0.39%	NA
Tropical Japonica	504	82.10%	17.10%	0.60%	0.20%	NA
Japonica Intermediate	241	91.70%	7.50%	0.41%	0.41%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	48.90%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615245465	T -> C	LOC_Os06g26050.1	upstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:19.555; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0615245465	T -> C	LOC_Os06g26060.1	upstream_gene_variant ; 3469.0bp to feature; MODIFIER	silent_mutation	Average:19.555; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0615245465	T -> C	LOC_Os06g26040.1	downstream_gene_variant ; 4154.0bp to feature; MODIFIER	silent_mutation	Average:19.555; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0615245465	T -> C	LOC_Os06g26050-LOC_Os06g26060	intergenic_region ; MODIFIER	silent_mutation	Average:19.555; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0615245465	T -> DEL	N	N	silent_mutation	Average:19.555; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615245465	3.16E-07	NA	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	6.03E-06	1.42E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	1.44E-06	3.21E-09	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	1.03E-07	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	1.65E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	4.07E-07	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	4.39E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	8.53E-09	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	4.37E-07	5.44E-10	mr1395	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	6.21E-06	6.21E-06	mr1419	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	1.86E-07	1.33E-09	mr1618	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	4.22E-06	7.47E-09	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	4.82E-10	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	4.99E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	2.73E-06	mr1888	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	1.10E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615245465	NA	1.01E-10	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251