\
| Variant ID: vg0615221080 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15221080 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 195. )
ATCCATGTAAACGCGTCCTGAATGCGCGGAGGTGCATTTTGTCGCATGACAGATGTGTTTTCTCCTCAAAATACCTGCATGCACATAGTTCACCAACACT[A/G]
GTGGAAATGATTAGTAATAAACCCTACCACTAAGTTGGATACCATAATTTATTTCATTATATGCAAGTATTGACAGTCAAATATTATGATTTAAGGACCG
CGGTCCTTAAATCATAATATTTGACTGTCAATACTTGCATATAATGAAATAAATTATGGTATCCAACTTAGTGGTAGGGTTTATTACTAATCATTTCCAC[T/C]
AGTGTTGGTGAACTATGTGCATGCAGGTATTTTGAGGAGAAAACACATCTGTCATGCGACAAAATGCACCTCCGCGCATTCAGGACGCGTTTACATGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 36.00% | 1.67% | 22.98% | NA |
| All Indica | 2759 | 53.10% | 6.80% | 2.83% | 37.33% | NA |
| All Japonica | 1512 | 7.70% | 91.40% | 0.00% | 0.93% | NA |
| Aus | 269 | 85.50% | 2.60% | 0.37% | 11.52% | NA |
| Indica I | 595 | 86.10% | 4.70% | 1.68% | 7.56% | NA |
| Indica II | 465 | 75.90% | 3.40% | 2.37% | 18.28% | NA |
| Indica III | 913 | 15.40% | 8.70% | 3.72% | 72.18% | NA |
| Indica Intermediate | 786 | 58.30% | 8.10% | 2.93% | 30.66% | NA |
| Temperate Japonica | 767 | 1.80% | 96.60% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 17.10% | 82.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 6.60% | 92.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 48.90% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615221080 | A -> G | LOC_Os06g26000.1 | downstream_gene_variant ; 3703.0bp to feature; MODIFIER | silent_mutation | Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg0615221080 | A -> G | LOC_Os06g25990.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg0615221080 | A -> DEL | N | N | silent_mutation | Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615221080 | 3.90E-06 | 1.17E-06 | mr1019_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 1.39E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 3.42E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 2.59E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 8.39E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 8.57E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 7.66E-13 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 1.08E-07 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 6.96E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615221080 | NA | 6.53E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |