Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615221080:

Variant ID: vg0615221080 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15221080
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCATGTAAACGCGTCCTGAATGCGCGGAGGTGCATTTTGTCGCATGACAGATGTGTTTTCTCCTCAAAATACCTGCATGCACATAGTTCACCAACACT[A/G]
GTGGAAATGATTAGTAATAAACCCTACCACTAAGTTGGATACCATAATTTATTTCATTATATGCAAGTATTGACAGTCAAATATTATGATTTAAGGACCG

Reverse complement sequence

CGGTCCTTAAATCATAATATTTGACTGTCAATACTTGCATATAATGAAATAAATTATGGTATCCAACTTAGTGGTAGGGTTTATTACTAATCATTTCCAC[T/C]
AGTGTTGGTGAACTATGTGCATGCAGGTATTTTGAGGAGAAAACACATCTGTCATGCGACAAAATGCACCTCCGCGCATTCAGGACGCGTTTACATGGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.40%	36.00%	1.67%	22.98%	NA
All Indica	2759	53.10%	6.80%	2.83%	37.33%	NA
All Japonica	1512	7.70%	91.40%	0.00%	0.93%	NA
Aus	269	85.50%	2.60%	0.37%	11.52%	NA
Indica I	595	86.10%	4.70%	1.68%	7.56%	NA
Indica II	465	75.90%	3.40%	2.37%	18.28%	NA
Indica III	913	15.40%	8.70%	3.72%	72.18%	NA
Indica Intermediate	786	58.30%	8.10%	2.93%	30.66%	NA
Temperate Japonica	767	1.80%	96.60%	0.00%	1.56%	NA
Tropical Japonica	504	17.10%	82.70%	0.00%	0.20%	NA
Japonica Intermediate	241	6.60%	92.90%	0.00%	0.41%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	38.90%	48.90%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615221080	A -> G	LOC_Os06g26000.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg0615221080	A -> G	LOC_Os06g25990.1	intron_variant ; MODIFIER	silent_mutation	Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg0615221080	A -> DEL	N	N	silent_mutation	Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615221080	3.90E-06	1.17E-06	mr1019_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	1.39E-15	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	3.42E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	2.59E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	8.39E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	8.57E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	7.66E-13	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	1.08E-07	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	6.96E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080	NA	6.53E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251