\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615221080:

Variant ID: vg0615221080 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15221080
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCATGTAAACGCGTCCTGAATGCGCGGAGGTGCATTTTGTCGCATGACAGATGTGTTTTCTCCTCAAAATACCTGCATGCACATAGTTCACCAACACT[A/G]
GTGGAAATGATTAGTAATAAACCCTACCACTAAGTTGGATACCATAATTTATTTCATTATATGCAAGTATTGACAGTCAAATATTATGATTTAAGGACCG

Reverse complement sequence

CGGTCCTTAAATCATAATATTTGACTGTCAATACTTGCATATAATGAAATAAATTATGGTATCCAACTTAGTGGTAGGGTTTATTACTAATCATTTCCAC[T/C]
AGTGTTGGTGAACTATGTGCATGCAGGTATTTTGAGGAGAAAACACATCTGTCATGCGACAAAATGCACCTCCGCGCATTCAGGACGCGTTTACATGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 36.00% 1.67% 22.98% NA
All Indica  2759 53.10% 6.80% 2.83% 37.33% NA
All Japonica  1512 7.70% 91.40% 0.00% 0.93% NA
Aus  269 85.50% 2.60% 0.37% 11.52% NA
Indica I  595 86.10% 4.70% 1.68% 7.56% NA
Indica II  465 75.90% 3.40% 2.37% 18.28% NA
Indica III  913 15.40% 8.70% 3.72% 72.18% NA
Indica Intermediate  786 58.30% 8.10% 2.93% 30.66% NA
Temperate Japonica  767 1.80% 96.60% 0.00% 1.56% NA
Tropical Japonica  504 17.10% 82.70% 0.00% 0.20% NA
Japonica Intermediate  241 6.60% 92.90% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 38.90% 48.90% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615221080 A -> G LOC_Os06g26000.1 downstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0615221080 A -> G LOC_Os06g25990.1 intron_variant ; MODIFIER silent_mutation Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0615221080 A -> DEL N N silent_mutation Average:23.091; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615221080 3.90E-06 1.17E-06 mr1019_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 1.39E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 3.42E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 2.59E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 8.39E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 8.57E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 7.66E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 1.08E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 6.96E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615221080 NA 6.53E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251