\
| Variant ID: vg0615169965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15169965 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 53. )
AGGCTAGTACCATCCCCGGTCAATTAAGGACCGAGCCATGAATTTAAGCATGAAACGACCCCCGTACAACCGCACTTCTCGTATGGGTATAGACCTAGCG[A/G]
AATAGATAGCTGAGCGGAGGCAGTATCCATGCATAGTGGTTTCTTGATGTGTGAGGTAGGGGCTCTATGGTGGGGCAGCCATTGGTAGAACCGCGAGGCA
TGCCTCGCGGTTCTACCAATGGCTGCCCCACCATAGAGCCCCTACCTCACACATCAAGAAACCACTATGCATGGATACTGCCTCCGCTCAGCTATCTATT[T/C]
CGCTAGGTCTATACCCATACGAGAAGTGCGGTTGTACGGGGGTCGTTTCATGCTTAAATTCATGGCTCGGTCCTTAATTGACCGGGGATGGTACTAGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 4.30% | 8.13% | 54.93% | NA |
| All Indica | 2759 | 4.30% | 0.30% | 13.37% | 82.02% | NA |
| All Japonica | 1512 | 91.30% | 0.10% | 0.00% | 8.66% | NA |
| Aus | 269 | 2.60% | 68.00% | 4.09% | 25.28% | NA |
| Indica I | 595 | 5.00% | 0.00% | 4.71% | 90.25% | NA |
| Indica II | 465 | 2.20% | 0.20% | 8.17% | 89.46% | NA |
| Indica III | 913 | 2.50% | 0.00% | 23.00% | 74.48% | NA |
| Indica Intermediate | 786 | 7.00% | 1.00% | 11.83% | 80.15% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 82.30% | 0.20% | 0.00% | 17.46% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.00% | 0.00% | 7.47% | NA |
| VI/Aromatic | 96 | 1.00% | 4.20% | 0.00% | 94.79% | NA |
| Intermediate | 90 | 38.90% | 8.90% | 4.44% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615169965 | A -> G | LOC_Os06g25910-LOC_Os06g25920 | intergenic_region ; MODIFIER | silent_mutation | Average:13.425; most accessible tissue: Callus, score: 26.739 | N | N | N | N |
| vg0615169965 | A -> DEL | N | N | silent_mutation | Average:13.425; most accessible tissue: Callus, score: 26.739 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615169965 | 7.64E-07 | 8.60E-09 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.10E-10 | 1.10E-10 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.27E-06 | 4.02E-12 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.32E-08 | 1.32E-08 | mr1165 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | NA | 2.75E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.33E-11 | 1.33E-11 | mr1478 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.09E-08 | 1.09E-08 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | NA | 4.13E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | 1.07E-09 | 2.19E-12 | mr1971 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615169965 | NA | 2.17E-08 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |