\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615113512:

Variant ID: vg0615113512 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15113512
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGATGCTGGCGGCTTGTCGTCCATGAGAGAAAATTTCTGACTTCTAATCTGTCCCACCGGGTGTGCCAAAAGCGTGTTGATGGAAAACACGAGGCCTGG[A/G]
AGATCTGCTTAACTCCAGTGCAGGTCCAAACTCGCCTTCGGGTATGCTAGCGTGCCAGTTGATTTGATCCTGTAATAAAAAAGAAATAGATACAAGCAAA

Reverse complement sequence

TTTGCTTGTATCTATTTCTTTTTTATTACAGGATCAAATCAACTGGCACGCTAGCATACCCGAAGGCGAGTTTGGACCTGCACTGGAGTTAAGCAGATCT[T/C]
CCAGGCCTCGTGTTTTCCATCAACACGCTTTTGGCACACCCGGTGGGACAGATTAGAAGTCAGAAATTTTCTCTCATGGACGACAAGCCGCCAGCATCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 5.20% 1.67% 55.33% NA
All Indica  2759 4.90% 8.80% 2.32% 83.94% NA
All Japonica  1512 91.50% 0.00% 0.20% 8.27% NA
Aus  269 70.60% 0.40% 4.46% 24.54% NA
Indica I  595 7.90% 9.40% 2.69% 80.00% NA
Indica II  465 3.00% 4.30% 2.37% 90.32% NA
Indica III  913 1.80% 12.70% 1.86% 83.68% NA
Indica Intermediate  786 7.50% 6.50% 2.54% 83.46% NA
Temperate Japonica  767 96.60% 0.00% 0.13% 3.26% NA
Tropical Japonica  504 83.30% 0.00% 0.40% 16.27% NA
Japonica Intermediate  241 92.50% 0.00% 0.00% 7.47% NA
VI/Aromatic  96 26.00% 1.00% 0.00% 72.92% NA
Intermediate  90 54.40% 3.30% 0.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615113512 A -> G LOC_Os06g25860.1 downstream_gene_variant ; 2046.0bp to feature; MODIFIER silent_mutation Average:6.277; most accessible tissue: Callus, score: 18.587 N N N N
vg0615113512 A -> G LOC_Os06g25870.1 downstream_gene_variant ; 4550.0bp to feature; MODIFIER silent_mutation Average:6.277; most accessible tissue: Callus, score: 18.587 N N N N
vg0615113512 A -> G LOC_Os06g25860-LOC_Os06g25870 intergenic_region ; MODIFIER silent_mutation Average:6.277; most accessible tissue: Callus, score: 18.587 N N N N
vg0615113512 A -> DEL N N silent_mutation Average:6.277; most accessible tissue: Callus, score: 18.587 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615113512 NA 3.82E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 9.77E-08 mr1045 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 3.60E-50 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 4.57E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 2.67E-53 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.02E-51 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 5.40E-42 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 2.48E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 2.36E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.22E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 6.02E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 3.47E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.72E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.12E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.10E-25 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 4.61E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.07E-06 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.15E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615113512 NA 1.01E-21 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251