\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615112980:

Variant ID: vg0615112980 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15112980
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCTCGAGTTCCGGTCCGCTTTGATTTTATACTTTTTGGGGGGTCTCCAAGCATCCATCTTCCACACCTTGGACTAATGCACCTGAAAGCTACTCAAT[G/A]
AGCTCATTAGTCCCTTAACCACATTTGTCATTAATCACCAAAACCCACTAGGAGGATTAATGCACTTTCAAACTCCCTGTACTCCTTGGGAGTTGTCACC

Reverse complement sequence

GGTGACAACTCCCAAGGAGTACAGGGAGTTTGAAAGTGCATTAATCCTCCTAGTGGGTTTTGGTGATTAATGACAAATGTGGTTAAGGGACTAATGAGCT[C/T]
ATTGAGTAGCTTTCAGGTGCATTAGTCCAAGGTGTGGAAGATGGATGCTTGGAGACCCCCCAAAAAGTATAAAATCAAAGCGGACCGGAACTCGAGAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 29.70% 0.87% 32.08% NA
All Indica  2759 4.50% 44.90% 1.01% 49.55% NA
All Japonica  1512 91.30% 6.20% 0.66% 1.85% NA
Aus  269 70.30% 17.50% 0.74% 11.52% NA
Indica I  595 7.90% 13.30% 0.17% 78.66% NA
Indica II  465 3.20% 24.50% 1.29% 70.97% NA
Indica III  913 1.00% 80.50% 1.86% 16.65% NA
Indica Intermediate  786 6.70% 39.70% 0.51% 53.05% NA
Temperate Japonica  767 96.70% 2.00% 0.00% 1.30% NA
Tropical Japonica  504 82.50% 13.10% 1.59% 2.78% NA
Japonica Intermediate  241 92.50% 5.00% 0.83% 1.66% NA
VI/Aromatic  96 26.00% 4.20% 0.00% 69.79% NA
Intermediate  90 51.10% 22.20% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615112980 G -> A LOC_Os06g25860.1 downstream_gene_variant ; 1514.0bp to feature; MODIFIER silent_mutation Average:8.896; most accessible tissue: Callus, score: 18.91 N N N N
vg0615112980 G -> A LOC_Os06g25860-LOC_Os06g25870 intergenic_region ; MODIFIER silent_mutation Average:8.896; most accessible tissue: Callus, score: 18.91 N N N N
vg0615112980 G -> DEL N N silent_mutation Average:8.896; most accessible tissue: Callus, score: 18.91 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615112980 NA 2.62E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 1.52E-07 1.52E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 NA 1.92E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 3.61E-06 3.61E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 6.76E-06 5.38E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 1.68E-08 1.68E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 4.03E-06 1.08E-06 mr1519 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 5.83E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 1.43E-07 1.43E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 NA 6.99E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 NA 1.70E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 5.34E-06 7.28E-09 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 6.50E-06 5.48E-09 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 6.57E-06 4.18E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615112980 8.88E-06 8.88E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251