\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615093098:

Variant ID: vg0615093098 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15093098
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTCGATTTGATGGAAACAGCTGCTTCTGGTTATAGATTGAATTGATCGGGGATGAGTGACGCCCGGTTGACTGGTTTGGTCCAGTTGGAAATTTTGGC[A/G]
ATGGCAATGAAAGGCAGACTCCAGAAGAGAAGAACCAGTCCGAAGATGAAGGCGATGTCGACGGAAGTGGATCTCATGCTACAGAAGCCAAGACGATACC

Reverse complement sequence

GGTATCGTCTTGGCTTCTGTAGCATGAGATCCACTTCCGTCGACATCGCCTTCATCTTCGGACTGGTTCTTCTCTTCTGGAGTCTGCCTTTCATTGCCAT[T/C]
GCCAAAATTTCCAACTGGACCAAACCAGTCAACCGGGCGTCACTCATCCCCGATCAATTCAATCTATAACCAGAAGCAGCTGTTTCCATCAAATCGACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 32.10% 0.11% 5.37% NA
All Indica  2759 96.80% 2.80% 0.11% 0.25% NA
All Japonica  1512 8.80% 91.00% 0.07% 0.13% NA
Aus  269 31.60% 1.50% 0.00% 66.91% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.30% 0.40% 0.11% 0.11% NA
Indica Intermediate  786 94.30% 4.70% 0.25% 0.76% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 17.70% 82.10% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 92.10% 0.00% 0.41% NA
VI/Aromatic  96 17.70% 22.90% 0.00% 59.38% NA
Intermediate  90 50.00% 40.00% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615093098 A -> G LOC_Os06g25830.1 upstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:53.773; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0615093098 A -> G LOC_Os06g25840.1 downstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:53.773; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0615093098 A -> G LOC_Os06g25830-LOC_Os06g25840 intergenic_region ; MODIFIER silent_mutation Average:53.773; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0615093098 A -> DEL N N silent_mutation Average:53.773; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615093098 NA 1.66E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 3.35E-24 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 3.58E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 1.47E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 7.62E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 9.74E-09 9.74E-09 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 3.86E-06 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 4.46E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 8.66E-07 8.66E-07 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 9.34E-23 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 2.28E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 2.03E-09 2.03E-09 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 2.20E-07 2.20E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 1.14E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 2.60E-24 mr1971 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 3.25E-07 5.19E-10 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 2.74E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 2.42E-54 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 2.45E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 1.15E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 4.82E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615093098 NA 5.73E-23 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251