\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615048733:

Variant ID: vg0615048733 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15048733
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATTCCTACCTCGTTTTTTGTCATCGATGGGAAGGGTTCTTACAGCTTGTTGCTTGGAAGGGATTGGATTCACGCCAATTGTTGCATTCCTTCAACTAT[G/A]
CATCAATGTTTGATTCAGTGGCAAGGCGACAAGATAGAGATCGTTCCAGCCGACAGGTCAGTTAATGTTGCCAGTGCCGATTTAGCTCTTTGGGAGATGG

Reverse complement sequence

CCATCTCCCAAAGAGCTAAATCGGCACTGGCAACATTAACTGACCTGTCGGCTGGAACGATCTCTATCTTGTCGCCTTGCCACTGAATCAAACATTGATG[C/T]
ATAGTTGAAGGAATGCAACAATTGGCGTGAATCCAATCCCTTCCAAGCAACAAGCTGTAAGAACCCTTCCCATCGATGACAAAAAACGAGGTAGGAATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 32.10% 0.15% 1.25% NA
All Indica  2759 96.80% 3.00% 0.04% 0.14% NA
All Japonica  1512 9.00% 90.90% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.10% 5.40% 0.17% 0.34% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 94.80% 5.10% 0.00% 0.13% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.10% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 19.80% 4.17% 54.17% NA
Intermediate  90 57.80% 37.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615048733 G -> A LOC_Os06g25760.1 missense_variant ; p.Met728Ile; MODERATE nonsynonymous_codon ; M728V Average:31.289; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 benign 0.88 TOLERATED 0.10
vg0615048733 G -> A LOC_Os06g25760.1 missense_variant ; p.Met728Ile; MODERATE nonsynonymous_codon ; M728I Average:31.289; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 benign 0.39 DELETERIOUS 0.01
vg0615048733 G -> DEL LOC_Os06g25760.1 N frameshift_variant Average:31.289; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615048733 4.96E-09 2.37E-78 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 7.26E-08 NA mr1068 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 1.22E-06 1.23E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 2.48E-07 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 9.36E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 4.75E-07 NA mr1096 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 3.34E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 3.06E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 3.97E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 4.20E-06 6.39E-42 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 1.37E-06 4.31E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 1.55E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 1.48E-71 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 3.09E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 1.42E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 1.12E-85 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 4.48E-09 2.45E-102 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 1.48E-70 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 5.68E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615048733 NA 3.25E-93 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251