\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615023142:

Variant ID: vg0615023142 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15023142
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGAGCAGCAAGGAAACTCCATCACCCAAGGGAGCTACTATACCTTTTGATTACAGCAAACTTACTATTCCCTCTCACAACTTTGTCTCCGTGCCTT[C/T]
CGGGCGTGCTCCTCAATTTGATGGGACGCATTACGCCGCTTGGAAGCACAAGATGAAGTTGCATCTAATCTCTTTGCATCCAAGTATTTGGAAAGTTGTT

Reverse complement sequence

AACAACTTTCCAAATACTTGGATGCAAAGAGATTAGATGCAACTTCATCTTGTGCTTCCAAGCGGCGTAATGCGTCCCATCAAATTGAGGAGCACGCCCG[G/A]
AAGGCACGGAGACAAAGTTGTGAGAGGGAATAGTAAGTTTGCTGTAATCAAAAGGTATAGTAGCTCCCTTGGGTGATGGAGTTTCCTTGCTGCTCACTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 40.00% 7.60% 2.26% NA
All Indica  2759 80.60% 9.90% 9.35% 0.11% NA
All Japonica  1512 2.10% 91.80% 1.19% 4.89% NA
Aus  269 23.80% 54.60% 20.07% 1.49% NA
Indica I  595 88.10% 7.70% 4.20% 0.00% NA
Indica II  465 86.90% 6.20% 6.24% 0.65% NA
Indica III  913 74.80% 12.30% 12.92% 0.00% NA
Indica Intermediate  786 78.10% 10.90% 10.94% 0.00% NA
Temperate Japonica  767 2.70% 96.70% 0.39% 0.13% NA
Tropical Japonica  504 1.20% 83.90% 2.78% 12.10% NA
Japonica Intermediate  241 2.10% 92.50% 0.41% 4.98% NA
VI/Aromatic  96 12.50% 37.50% 25.00% 25.00% NA
Intermediate  90 42.20% 50.00% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615023142 C -> T LOC_Os06g25710.1 upstream_gene_variant ; 4505.0bp to feature; MODIFIER silent_mutation Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0615023142 C -> T LOC_Os06g25720.1 upstream_gene_variant ; 2117.0bp to feature; MODIFIER silent_mutation Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0615023142 C -> T LOC_Os06g25730.1 upstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0615023142 C -> T LOC_Os06g25720-LOC_Os06g25730 intergenic_region ; MODIFIER silent_mutation Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0615023142 C -> DEL N N silent_mutation Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615023142 NA 7.01E-46 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 NA 6.84E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 NA 8.70E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 NA 1.98E-08 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 7.77E-07 1.38E-10 mr1548_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 NA 2.09E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142 NA 1.06E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251