Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0615023142:

Variant ID: vg0615023142 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15023142
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGTGAGCAGCAAGGAAACTCCATCACCCAAGGGAGCTACTATACCTTTTGATTACAGCAAACTTACTATTCCCTCTCACAACTTTGTCTCCGTGCCTT[C/T]
CGGGCGTGCTCCTCAATTTGATGGGACGCATTACGCCGCTTGGAAGCACAAGATGAAGTTGCATCTAATCTCTTTGCATCCAAGTATTTGGAAAGTTGTT

Reverse complement sequence

AACAACTTTCCAAATACTTGGATGCAAAGAGATTAGATGCAACTTCATCTTGTGCTTCCAAGCGGCGTAATGCGTCCCATCAAATTGAGGAGCACGCCCG[G/A]
AAGGCACGGAGACAAAGTTGTGAGAGGGAATAGTAAGTTTGCTGTAATCAAAAGGTATAGTAGCTCCCTTGGGTGATGGAGTTTCCTTGCTGCTCACTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	40.00%	7.60%	2.26%	NA
All Indica	2759	80.60%	9.90%	9.35%	0.11%	NA
All Japonica	1512	2.10%	91.80%	1.19%	4.89%	NA
Aus	269	23.80%	54.60%	20.07%	1.49%	NA
Indica I	595	88.10%	7.70%	4.20%	0.00%	NA
Indica II	465	86.90%	6.20%	6.24%	0.65%	NA
Indica III	913	74.80%	12.30%	12.92%	0.00%	NA
Indica Intermediate	786	78.10%	10.90%	10.94%	0.00%	NA
Temperate Japonica	767	2.70%	96.70%	0.39%	0.13%	NA
Tropical Japonica	504	1.20%	83.90%	2.78%	12.10%	NA
Japonica Intermediate	241	2.10%	92.50%	0.41%	4.98%	NA
VI/Aromatic	96	12.50%	37.50%	25.00%	25.00%	NA
Intermediate	90	42.20%	50.00%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615023142	C -> T	LOC_Os06g25710.1	upstream_gene_variant ; 4505.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427	N	N	N	N
vg0615023142	C -> T	LOC_Os06g25720.1	upstream_gene_variant ; 2117.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427	N	N	N	N
vg0615023142	C -> T	LOC_Os06g25730.1	upstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427	N	N	N	N
vg0615023142	C -> T	LOC_Os06g25720-LOC_Os06g25730	intergenic_region ; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427	N	N	N	N
vg0615023142	C -> DEL	N	N	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615023142	NA	7.01E-46	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	NA	6.84E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	NA	8.70E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	NA	1.98E-08	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	7.77E-07	1.38E-10	mr1548_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	NA	2.09E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615023142	NA	1.06E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251