\
| Variant ID: vg0615023142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15023142 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGAGTGAGCAGCAAGGAAACTCCATCACCCAAGGGAGCTACTATACCTTTTGATTACAGCAAACTTACTATTCCCTCTCACAACTTTGTCTCCGTGCCTT[C/T]
CGGGCGTGCTCCTCAATTTGATGGGACGCATTACGCCGCTTGGAAGCACAAGATGAAGTTGCATCTAATCTCTTTGCATCCAAGTATTTGGAAAGTTGTT
AACAACTTTCCAAATACTTGGATGCAAAGAGATTAGATGCAACTTCATCTTGTGCTTCCAAGCGGCGTAATGCGTCCCATCAAATTGAGGAGCACGCCCG[G/A]
AAGGCACGGAGACAAAGTTGTGAGAGGGAATAGTAAGTTTGCTGTAATCAAAAGGTATAGTAGCTCCCTTGGGTGATGGAGTTTCCTTGCTGCTCACTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 40.00% | 7.60% | 2.26% | NA |
| All Indica | 2759 | 80.60% | 9.90% | 9.35% | 0.11% | NA |
| All Japonica | 1512 | 2.10% | 91.80% | 1.19% | 4.89% | NA |
| Aus | 269 | 23.80% | 54.60% | 20.07% | 1.49% | NA |
| Indica I | 595 | 88.10% | 7.70% | 4.20% | 0.00% | NA |
| Indica II | 465 | 86.90% | 6.20% | 6.24% | 0.65% | NA |
| Indica III | 913 | 74.80% | 12.30% | 12.92% | 0.00% | NA |
| Indica Intermediate | 786 | 78.10% | 10.90% | 10.94% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 96.70% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 1.20% | 83.90% | 2.78% | 12.10% | NA |
| Japonica Intermediate | 241 | 2.10% | 92.50% | 0.41% | 4.98% | NA |
| VI/Aromatic | 96 | 12.50% | 37.50% | 25.00% | 25.00% | NA |
| Intermediate | 90 | 42.20% | 50.00% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615023142 | C -> T | LOC_Os06g25710.1 | upstream_gene_variant ; 4505.0bp to feature; MODIFIER | silent_mutation | Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0615023142 | C -> T | LOC_Os06g25720.1 | upstream_gene_variant ; 2117.0bp to feature; MODIFIER | silent_mutation | Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0615023142 | C -> T | LOC_Os06g25730.1 | upstream_gene_variant ; 3176.0bp to feature; MODIFIER | silent_mutation | Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0615023142 | C -> T | LOC_Os06g25720-LOC_Os06g25730 | intergenic_region ; MODIFIER | silent_mutation | Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0615023142 | C -> DEL | N | N | silent_mutation | Average:15.761; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615023142 | NA | 7.01E-46 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | NA | 6.84E-28 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | NA | 8.70E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | NA | 1.98E-08 | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | 7.77E-07 | 1.38E-10 | mr1548_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | NA | 2.09E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615023142 | NA | 1.06E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |