\
| Variant ID: vg0614992514 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14992514 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGCAACCTCAGTGATGAAAGTGCTGAGAAAGCAGCTGGAAGAGATTCCGGCAGATGTCCATGGGTTAGATGTAGATGATGGTGTGAGTGAGCATGAGGC[T/C]
GATGTTGGCGATGGAGCTGGGCCATCGATCCATCGGGGTGGAAGTGTTGGTGATGAAATTAGCAGGCGTCCACCGCCAAAGTCAATGACAAAAGGGAGGG
CCCTCCCTTTTGTCATTGACTTTGGCGGTGGACGCCTGCTAATTTCATCACCAACACTTCCACCCCGATGGATCGATGGCCCAGCTCCATCGCCAACATC[A/G]
GCCTCATGCTCACTCACACCATCATCTACATCTAACCCATGGACATCTGCCGGAATCTCTTCCAGCTGCTTTCTCAGCACTTTCATCACTGAGGTTGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 36.20% | 0.78% | 10.07% | NA |
| All Indica | 2759 | 81.40% | 3.70% | 0.83% | 14.03% | NA |
| All Japonica | 1512 | 7.90% | 90.90% | 0.07% | 1.12% | NA |
| Aus | 269 | 29.70% | 69.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 93.10% | 5.00% | 0.17% | 1.68% | NA |
| Indica II | 465 | 86.90% | 1.90% | 1.51% | 9.68% | NA |
| Indica III | 913 | 73.10% | 1.30% | 0.88% | 24.75% | NA |
| Indica Intermediate | 786 | 79.10% | 6.50% | 0.89% | 13.49% | NA |
| Temperate Japonica | 767 | 2.10% | 96.30% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 17.10% | 82.30% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 7.10% | 91.70% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 17.70% | 9.40% | 10.42% | 62.50% | NA |
| Intermediate | 90 | 42.20% | 42.20% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614992514 | T -> C | LOC_Os06g25660.1 | synonymous_variant ; p.Ala398Ala; LOW | synonymous_codon | Average:28.084; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0614992514 | T -> DEL | LOC_Os06g25660.1 | N | frameshift_variant | Average:28.084; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614992514 | 9.99E-06 | 3.03E-07 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 3.22E-08 | 3.22E-08 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 4.76E-07 | 4.76E-07 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | NA | 1.69E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 1.11E-08 | 1.11E-08 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 3.16E-07 | 3.16E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 5.74E-06 | 9.70E-09 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 3.30E-07 | 5.01E-10 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | 5.72E-07 | 1.38E-10 | mr1548_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614992514 | NA | 3.60E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |